Incidental Mutation 'R6215:Asnsd1'
ID503639
Institutional Source Beutler Lab
Gene Symbol Asnsd1
Ensembl Gene ENSMUSG00000026095
Gene Nameasparagine synthetase domain containing 1
Synonyms2210409M21Rik
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location53344617-53352752 bp(-) (GRCm38)
Type of Mutationsplice site (210 bp from exon)
DNA Base Change (assembly) A to C at 53348028 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027264] [ENSMUST00000123519] [ENSMUST00000144660] [ENSMUST00000147021] [ENSMUST00000154402]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027264
AA Change: F147V

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027264
Gene: ENSMUSG00000026095
AA Change: F147V

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 2.4e-8 PFAM
Pfam:Asn_synthase 305 388 6.9e-7 PFAM
Pfam:Asn_synthase 505 619 2.4e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123519
SMART Domains Protein: ENSMUSP00000139025
Gene: ENSMUSG00000026095

DomainStartEndE-ValueType
Pfam:Asn_synthase 2 120 4.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136468
Predicted Effect possibly damaging
Transcript: ENSMUST00000144660
AA Change: F147V

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139404
Gene: ENSMUSG00000099913
AA Change: F147V

DomainStartEndE-ValueType
Pfam:GATase_7 59 162 1.4e-8 PFAM
Pfam:Asn_synthase 304 565 5.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147021
Predicted Effect probably null
Transcript: ENSMUST00000154402
Meta Mutation Damage Score 0.2762 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Asnsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Asnsd1 APN 1 53346628 missense probably damaging 1.00
IGL00595:Asnsd1 APN 1 53347488 missense probably damaging 1.00
IGL00705:Asnsd1 APN 1 53348451 missense probably damaging 1.00
IGL01089:Asnsd1 APN 1 53348277 missense probably damaging 1.00
IGL01747:Asnsd1 APN 1 53348095 nonsense probably null
IGL02274:Asnsd1 APN 1 53347575 missense probably benign
R2021:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2022:Asnsd1 UTSW 1 53347227 missense possibly damaging 0.53
R2126:Asnsd1 UTSW 1 53347317 missense probably benign 0.00
R2174:Asnsd1 UTSW 1 53347601 missense probably benign 0.44
R4120:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R4435:Asnsd1 UTSW 1 53348073 splice site probably null
R4464:Asnsd1 UTSW 1 53352527 splice site probably null
R4499:Asnsd1 UTSW 1 53347970 missense probably benign
R4622:Asnsd1 UTSW 1 53348219 missense probably benign 0.13
R5090:Asnsd1 UTSW 1 53352404 unclassified probably benign
R5832:Asnsd1 UTSW 1 53347475 missense probably damaging 1.00
R5891:Asnsd1 UTSW 1 53347977 missense probably benign 0.00
R6217:Asnsd1 UTSW 1 53348028 missense probably benign 0.02
R6353:Asnsd1 UTSW 1 53347779 missense probably benign
R6405:Asnsd1 UTSW 1 53347995 missense probably damaging 1.00
R6913:Asnsd1 UTSW 1 53348231 missense probably damaging 0.99
R7217:Asnsd1 UTSW 1 53348193 missense probably damaging 1.00
R7570:Asnsd1 UTSW 1 53348258 missense probably damaging 1.00
R7589:Asnsd1 UTSW 1 53347967 missense probably benign 0.00
R7716:Asnsd1 UTSW 1 53347743 missense probably benign 0.05
R8314:Asnsd1 UTSW 1 53346655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCCTGCTGGAGTCTGAGTC -3'
(R):5'- AGATAATGACACCCAGGTTATGTTC -3'

Sequencing Primer
(F):5'- CGGCAATATCCTCCTTAGAAATG -3'
(R):5'- GACACCCAGGTTATGTTCAATAGC -3'
Posted On2018-02-27