Incidental Mutation 'R6215:Kcnj13'
ID503641
Institutional Source Beutler Lab
Gene Symbol Kcnj13
Ensembl Gene ENSMUSG00000079436
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 13
Synonyms
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87386363-87394729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87386534 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 322 (V322A)
Ref Sequence ENSEMBL: ENSMUSP00000108838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000113212] [ENSMUST00000164992] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173173] [ENSMUST00000174179] [ENSMUST00000174334] [ENSMUST00000174501]
Predicted Effect probably benign
Transcript: ENSMUST00000027475
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113212
AA Change: V322A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108838
Gene: ENSMUSG00000079436
AA Change: V322A

DomainStartEndE-ValueType
Pfam:IRK 21 345 3.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164992
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172794
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172964
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173173
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173850
Predicted Effect probably benign
Transcript: ENSMUST00000174179
SMART Domains Protein: ENSMUSP00000133524
Gene: ENSMUSG00000079436

DomainStartEndE-ValueType
Pfam:IRK 21 80 1.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174334
SMART Domains Protein: ENSMUSP00000133666
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 77 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174501
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174535
Meta Mutation Damage Score 0.1354 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inwardly rectifying potassium channel family of proteins. Members of this family form ion channel pores that allow potassium ions to pass into a cell. The encoded protein belongs to a subfamily of low signal channel conductance proteins that have a low dependence on potassium concentration. Mutations in this gene are associated with snowflake vitreoretinal degeneration. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutant null mice die shortly after birth, exhibit cleft palate and pulmonary abnormalities in embryonic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Kcnj13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Kcnj13 APN 1 87386978 missense probably benign 0.02
IGL01108:Kcnj13 APN 1 87386937 missense probably benign
IGL01420:Kcnj13 APN 1 87389044 missense probably damaging 1.00
IGL02747:Kcnj13 APN 1 87389365 missense probably benign 0.00
IGL02937:Kcnj13 APN 1 87386453 missense probably damaging 1.00
R0472:Kcnj13 UTSW 1 87386846 missense probably benign 0.22
R0486:Kcnj13 UTSW 1 87387030 missense probably damaging 1.00
R1494:Kcnj13 UTSW 1 87389217 missense probably damaging 1.00
R2131:Kcnj13 UTSW 1 87386534 missense probably benign 0.03
R2392:Kcnj13 UTSW 1 87386900 missense possibly damaging 0.83
R3418:Kcnj13 UTSW 1 87386919 missense probably benign 0.08
R3419:Kcnj13 UTSW 1 87386919 missense probably benign 0.08
R5773:Kcnj13 UTSW 1 87386667 missense probably damaging 0.99
R6284:Kcnj13 UTSW 1 87386886 missense probably damaging 1.00
R6773:Kcnj13 UTSW 1 87386760 missense possibly damaging 0.82
R6830:Kcnj13 UTSW 1 87387023 missense probably damaging 1.00
R7365:Kcnj13 UTSW 1 87389017 missense probably damaging 1.00
R8297:Kcnj13 UTSW 1 87386467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGCATAGACATCATTACTATG -3'
(R):5'- AGCTACCCTGCTCCAACATG -3'

Sequencing Primer
(F):5'- TGATATAATCAGCACTGAGAACAAGG -3'
(R):5'- GAGACTCCTCCACACTTTGAATTAG -3'
Posted On2018-02-27