Incidental Mutation 'R6215:Dhx9'
ID503642
Institutional Source Beutler Lab
Gene Symbol Dhx9
Ensembl Gene ENSMUSG00000042699
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 9
Synonymsleukophysin, Ddx9, RNA helicase, nuclear DNA helicase II, NDHII, NDH II, RHA
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location153455758-153487660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 153472463 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 336 (P336S)
Ref Sequence ENSEMBL: ENSMUSP00000139806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042141] [ENSMUST00000186380] [ENSMUST00000186966] [ENSMUST00000188345]
Predicted Effect probably damaging
Transcript: ENSMUST00000042141
AA Change: P337S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038135
Gene: ENSMUSG00000042699
AA Change: P337S

DomainStartEndE-ValueType
DSRM 4 70 2.23e-17 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 3.52e-15 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 1.61e-25 SMART
low complexity region 592 608 N/A INTRINSIC
HELICc 667 772 4.69e-18 SMART
HA2 834 922 1.33e-24 SMART
Pfam:OB_NTP_bind 961 1077 1.6e-18 PFAM
low complexity region 1173 1309 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1339 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186380
AA Change: P336S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139825
Gene: ENSMUSG00000042699
AA Change: P336S

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 388 575 6.6e-28 SMART
low complexity region 591 607 N/A INTRINSIC
HELICc 666 771 1.9e-20 SMART
HA2 833 921 9.9e-29 SMART
Pfam:OB_NTP_bind 960 1076 5e-13 PFAM
low complexity region 1172 1308 N/A INTRINSIC
low complexity region 1312 1336 N/A INTRINSIC
low complexity region 1338 1383 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186966
AA Change: P336S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139806
Gene: ENSMUSG00000042699
AA Change: P336S

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 183 253 2.1e-17 SMART
low complexity region 283 298 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
Blast:DEXDc 349 451 1e-37 BLAST
PDB:3LLM|B 349 456 2e-55 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000188345
AA Change: P337S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139827
Gene: ENSMUSG00000042699
AA Change: P337S

DomainStartEndE-ValueType
DSRM 4 70 1.3e-19 SMART
low complexity region 80 91 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
DSRM 184 254 2.1e-17 SMART
low complexity region 284 299 N/A INTRINSIC
low complexity region 334 349 N/A INTRINSIC
DEXDc 389 576 6.6e-28 SMART
low complexity region 592 608 N/A INTRINSIC
Pfam:Helicase_C 678 735 6.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189516
Predicted Effect probably benign
Transcript: ENSMUST00000190544
Meta Mutation Damage Score 0.1962 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH-containing family of RNA helicases. The encoded protein is an enzyme that catalyzes the ATP-dependent unwinding of double-stranded RNA and DNA-RNA complexes. This protein localizes to both the nucleus and the cytoplasm and functions as a transcriptional regulator. This protein may also be involved in the expression and nuclear export of retroviral RNAs. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 11 and 13.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes die in embryonic stages with massive apoptotic cell death in embryonic ectodermal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Dhx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Dhx9 APN 1 153465748 missense probably damaging 1.00
IGL01284:Dhx9 APN 1 153464898 missense probably damaging 1.00
IGL01555:Dhx9 APN 1 153459566 missense probably damaging 1.00
IGL01767:Dhx9 APN 1 153468868 splice site probably benign
IGL02938:Dhx9 APN 1 153464630 missense probably benign 0.37
R0001:Dhx9 UTSW 1 153462636 missense probably damaging 1.00
R0046:Dhx9 UTSW 1 153472707 missense probably benign 0.27
R0309:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R0517:Dhx9 UTSW 1 153478916 missense possibly damaging 0.93
R0589:Dhx9 UTSW 1 153472291 missense probably damaging 1.00
R1217:Dhx9 UTSW 1 153458363 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1406:Dhx9 UTSW 1 153464938 missense probably damaging 1.00
R1430:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R1456:Dhx9 UTSW 1 153465695 missense probably benign 0.00
R1460:Dhx9 UTSW 1 153465680 missense probably benign 0.01
R1724:Dhx9 UTSW 1 153458488 missense probably benign 0.00
R1848:Dhx9 UTSW 1 153465753 missense probably damaging 0.99
R1922:Dhx9 UTSW 1 153460274 splice site probably null
R2001:Dhx9 UTSW 1 153456111 nonsense probably null
R3084:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3085:Dhx9 UTSW 1 153465699 missense probably benign 0.34
R3123:Dhx9 UTSW 1 153465706 missense possibly damaging 0.90
R3730:Dhx9 UTSW 1 153478120 missense probably benign 0.16
R4274:Dhx9 UTSW 1 153468926 missense probably damaging 1.00
R4353:Dhx9 UTSW 1 153471789 missense probably damaging 1.00
R4560:Dhx9 UTSW 1 153467157 missense probably damaging 1.00
R4583:Dhx9 UTSW 1 153460303 missense probably damaging 0.98
R4598:Dhx9 UTSW 1 153467051 frame shift probably null
R4603:Dhx9 UTSW 1 153467051 frame shift probably null
R4889:Dhx9 UTSW 1 153481149 missense probably damaging 1.00
R4931:Dhx9 UTSW 1 153472673 missense probably benign 0.02
R5411:Dhx9 UTSW 1 153481223 missense probably benign 0.27
R5569:Dhx9 UTSW 1 153467092 missense possibly damaging 0.83
R5635:Dhx9 UTSW 1 153483747 missense probably benign 0.44
R5659:Dhx9 UTSW 1 153471735 missense probably damaging 1.00
R6128:Dhx9 UTSW 1 153478089 missense probably damaging 1.00
R6428:Dhx9 UTSW 1 153456578 unclassified probably benign
R6489:Dhx9 UTSW 1 153456643 unclassified probably benign
R6717:Dhx9 UTSW 1 153473464 intron probably null
R7098:Dhx9 UTSW 1 153465022 missense probably benign
R7209:Dhx9 UTSW 1 153464623 missense possibly damaging 0.90
R7226:Dhx9 UTSW 1 153465677 missense probably benign 0.00
R7440:Dhx9 UTSW 1 153481231 missense probably benign
R7685:Dhx9 UTSW 1 153458406 missense probably damaging 0.99
R7712:Dhx9 UTSW 1 153465001 missense probably benign 0.07
R8088:Dhx9 UTSW 1 153462697 missense probably benign 0.26
R8371:Dhx9 UTSW 1 153456215 missense unknown
R8397:Dhx9 UTSW 1 153468911 missense probably damaging 1.00
X0066:Dhx9 UTSW 1 153472529 missense probably benign 0.00
Z1177:Dhx9 UTSW 1 153456575 missense unknown
Predicted Primers PCR Primer
(F):5'- CATGCTTATTTGTTCTGTAGAAGCC -3'
(R):5'- AGCTAGATCTTGAAATTGTGCCCC -3'

Sequencing Primer
(F):5'- TGTTCTGTAGAAGCCTGTAAAAAG -3'
(R):5'- CTTGAAATTGTGCCCCCAGTAAG -3'
Posted On2018-02-27