Incidental Mutation 'R6215:Ppp2r5a'
ID503643
Institutional Source Beutler Lab
Gene Symbol Ppp2r5a
Ensembl Gene ENSMUSG00000026626
Gene Nameprotein phosphatase 2, regulatory subunit B', alpha
Synonyms
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location191351975-191403272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 191362250 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 191 (Q191L)
Ref Sequence ENSEMBL: ENSMUSP00000070726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067976]
Predicted Effect probably benign
Transcript: ENSMUST00000067976
AA Change: Q191L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000070726
Gene: ENSMUSG00000026626
AA Change: Q191L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:B56 56 462 3.6e-193 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000191925
AA Change: Q59L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195605
Meta Mutation Damage Score 0.2043 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B56 subfamily. Alternative transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Ppp2r5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03297:Ppp2r5a APN 1 191354762 missense probably benign 0.28
R1640:Ppp2r5a UTSW 1 191353929 missense probably damaging 0.99
R3005:Ppp2r5a UTSW 1 191358976 missense probably damaging 1.00
R4810:Ppp2r5a UTSW 1 191356392 unclassified probably benign
R5730:Ppp2r5a UTSW 1 191372535 missense probably benign 0.04
R5769:Ppp2r5a UTSW 1 191372666 missense probably benign 0.02
R5783:Ppp2r5a UTSW 1 191354640 missense probably damaging 0.98
R7311:Ppp2r5a UTSW 1 191357801 missense probably damaging 1.00
R7485:Ppp2r5a UTSW 1 191396335 missense probably benign 0.07
R7545:Ppp2r5a UTSW 1 191372609 missense probably benign 0.00
V5622:Ppp2r5a UTSW 1 191358992 missense probably damaging 1.00
V5622:Ppp2r5a UTSW 1 191359001 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCCATTTTGCCTGCATGTATG -3'
(R):5'- CAACTCACGCTAGTAAGAAAGGTG -3'

Sequencing Primer
(F):5'- TCACCAACAGTTGTGAGCTG -3'
(R):5'- TCACGCTAGTAAGAAAGGTGGTTGG -3'
Posted On2018-02-27