Incidental Mutation 'R6215:Sh3glb2'
ID503644
Institutional Source Beutler Lab
Gene Symbol Sh3glb2
Ensembl Gene ENSMUSG00000026860
Gene NameSH3-domain GRB2-like endophilin B2
SynonymsSPAS-1; mKIAA1848
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30344809-30359337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30345793 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 313 (E313G)
Ref Sequence ENSEMBL: ENSMUSP00000131545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028214] [ENSMUST00000064447] [ENSMUST00000100215] [ENSMUST00000113620] [ENSMUST00000113621] [ENSMUST00000163668]
Predicted Effect probably benign
Transcript: ENSMUST00000028214
AA Change: E329G

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028214
Gene: ENSMUSG00000026860
AA Change: E329G

DomainStartEndE-ValueType
BAR 7 280 8.25e-92 SMART
low complexity region 288 334 N/A INTRINSIC
SH3 338 395 2.16e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064447
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100215
AA Change: E334G

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097788
Gene: ENSMUSG00000026860
AA Change: E334G

DomainStartEndE-ValueType
BAR 7 280 4.42e-92 SMART
low complexity region 293 339 N/A INTRINSIC
SH3 343 400 2.16e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113620
AA Change: E308G

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109250
Gene: ENSMUSG00000026860
AA Change: E308G

DomainStartEndE-ValueType
BAR 7 259 3.85e-92 SMART
low complexity region 267 313 N/A INTRINSIC
SH3 317 374 2.16e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113621
AA Change: E338G

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109251
Gene: ENSMUSG00000026860
AA Change: E338G

DomainStartEndE-ValueType
BAR 7 284 5.36e-91 SMART
low complexity region 297 343 N/A INTRINSIC
SH3 347 404 2.16e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142720
Predicted Effect possibly damaging
Transcript: ENSMUST00000163668
AA Change: E313G

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131545
Gene: ENSMUSG00000026860
AA Change: E313G

DomainStartEndE-ValueType
BAR 7 259 2.06e-92 SMART
low complexity region 272 318 N/A INTRINSIC
SH3 322 379 2.16e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151354
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Sh3glb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Sh3glb2 APN 2 30345850 missense possibly damaging 0.73
IGL02189:Sh3glb2 APN 2 30345339 splice site probably null
IGL02724:Sh3glb2 APN 2 30346356 missense probably benign 0.02
IGL03352:Sh3glb2 APN 2 30345351 missense probably damaging 1.00
little UTSW 2 30354975 missense probably damaging 1.00
R1162:Sh3glb2 UTSW 2 30350588 missense probably damaging 1.00
R1517:Sh3glb2 UTSW 2 30354975 missense probably damaging 1.00
R1725:Sh3glb2 UTSW 2 30350667 nonsense probably null
R3894:Sh3glb2 UTSW 2 30355288 missense probably damaging 0.97
R4523:Sh3glb2 UTSW 2 30350699 missense probably damaging 0.98
R5587:Sh3glb2 UTSW 2 30354851 critical splice donor site probably null
R5933:Sh3glb2 UTSW 2 30350389 splice site probably null
R6679:Sh3glb2 UTSW 2 30350619 missense probably damaging 1.00
R6998:Sh3glb2 UTSW 2 30355321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGAGAGTGAGCAGAGTTG -3'
(R):5'- CCTTGTGTGTAAAATGGGCC -3'

Sequencing Primer
(F):5'- TGTGCAGATTCAGTGTCCC -3'
(R):5'- CTCTCACAGGTTAGTGATGGC -3'
Posted On2018-02-27