Incidental Mutation 'R6215:Prom2'
ID503648
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Nameprominin 2
Synonyms
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127526473-127541467 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 127539775 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
Predicted Effect probably null
Transcript: ENSMUST00000028855
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103214
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155581
Meta Mutation Damage Score 0.9480 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127541139 missense probably benign 0.04
IGL01140:Prom2 APN 2 127531205 splice site probably benign
IGL01300:Prom2 APN 2 127535089 missense probably benign 0.44
IGL01445:Prom2 APN 2 127539513 splice site probably benign
IGL01472:Prom2 APN 2 127532882 missense probably benign 0.39
IGL01541:Prom2 APN 2 127529130 critical splice donor site probably null
IGL01991:Prom2 APN 2 127529222 missense probably damaging 1.00
IGL02421:Prom2 APN 2 127531882 critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127529471 missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127538657 splice site probably benign
IGL02826:Prom2 APN 2 127531116 missense probably benign 0.07
IGL02830:Prom2 APN 2 127535069 missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127528814 missense probably benign 0.10
R0110:Prom2 UTSW 2 127531113 missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127538338 splice site probably benign
R0165:Prom2 UTSW 2 127539514 splice site probably benign
R0220:Prom2 UTSW 2 127541107 missense probably benign 0.03
R0466:Prom2 UTSW 2 127528789 missense probably damaging 0.99
R0505:Prom2 UTSW 2 127532867 missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127539995 critical splice donor site probably null
R0633:Prom2 UTSW 2 127539525 missense probably benign 0.19
R0947:Prom2 UTSW 2 127538263 missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127540162 missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127532882 missense probably damaging 1.00
R1859:Prom2 UTSW 2 127541097 missense probably damaging 0.97
R1864:Prom2 UTSW 2 127539787 missense probably benign 0.00
R1866:Prom2 UTSW 2 127536594 missense probably damaging 0.99
R3824:Prom2 UTSW 2 127535673 splice site probably benign
R4472:Prom2 UTSW 2 127540191 missense probably benign 0.06
R5078:Prom2 UTSW 2 127531837 missense probably benign 0.00
R5889:Prom2 UTSW 2 127529411 missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127530133 nonsense probably null
R6214:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6914:Prom2 UTSW 2 127530375 missense possibly damaging 0.78
R7099:Prom2 UTSW 2 127539778 missense probably benign
R7427:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7428:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7525:Prom2 UTSW 2 127532781 missense probably benign
Z1176:Prom2 UTSW 2 127532775 missense probably damaging 1.00
Z1177:Prom2 UTSW 2 127538305 missense probably damaging 1.00
Z1177:Prom2 UTSW 2 127539526 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTCCTAAGCAAACACAGGGG -3'
(R):5'- TTCTGTGAGAGGCTCCCTAG -3'

Sequencing Primer
(F):5'- CCTAAGCAAACACAGGGGCATTAG -3'
(R):5'- TGTGAGAGGCTCCCTAGGTCAG -3'
Posted On2018-02-27