Incidental Mutation 'R6215:Catsperg1'
ID503658
Institutional Source Beutler Lab
Gene Symbol Catsperg1
Ensembl Gene ENSMUSG00000049676
Gene Namecation channel sperm associated auxiliary subunit gamma 1
SynonymsA230107C01Rik, Catsperg
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location29181321-29214035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29200239 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 339 (V339A)
Ref Sequence ENSEMBL: ENSMUSP00000129837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047846] [ENSMUST00000069861] [ENSMUST00000163782] [ENSMUST00000164653] [ENSMUST00000169143]
Predicted Effect probably damaging
Transcript: ENSMUST00000047846
AA Change: V339A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045233
Gene: ENSMUSG00000049676
AA Change: V339A

DomainStartEndE-ValueType
Pfam:CATSPERG 1 920 N/A PFAM
transmembrane domain 1012 1034 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069861
AA Change: V137A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067388
Gene: ENSMUSG00000049676
AA Change: V137A

DomainStartEndE-ValueType
Pfam:CATSPERG 1 57 7.9e-14 PFAM
Pfam:CATSPERG 73 205 7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163614
Predicted Effect probably benign
Transcript: ENSMUST00000163782
SMART Domains Protein: ENSMUSP00000127409
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 93 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164653
AA Change: V172A

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131827
Gene: ENSMUSG00000049676
AA Change: V172A

DomainStartEndE-ValueType
Pfam:CATSPERG 1 111 1.4e-44 PFAM
Pfam:CATSPERG 108 334 8.5e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166654
Predicted Effect probably damaging
Transcript: ENSMUST00000169143
AA Change: V339A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129837
Gene: ENSMUSG00000049676
AA Change: V339A

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1111 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172226
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Catsperg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Catsperg1 APN 7 29198146 missense probably damaging 1.00
IGL01693:Catsperg1 APN 7 29185098 unclassified probably benign
IGL01935:Catsperg1 APN 7 29195871 unclassified probably null
IGL02484:Catsperg1 APN 7 29210920 start gained probably benign
IGL02584:Catsperg1 APN 7 29184721 missense probably damaging 1.00
IGL02880:Catsperg1 APN 7 29195485 missense possibly damaging 0.75
IGL03268:Catsperg1 APN 7 29200243 missense probably damaging 1.00
IGL03285:Catsperg1 APN 7 29198172 missense possibly damaging 0.89
solid UTSW 7 29190298 nonsense probably null
K7894:Catsperg1 UTSW 7 29197154 intron probably benign
R0180:Catsperg1 UTSW 7 29190431 splice site probably null
R0344:Catsperg1 UTSW 7 29195540 missense probably damaging 1.00
R0523:Catsperg1 UTSW 7 29185190 unclassified probably benign
R0561:Catsperg1 UTSW 7 29182312 missense probably damaging 1.00
R0610:Catsperg1 UTSW 7 29190619 missense probably damaging 1.00
R0762:Catsperg1 UTSW 7 29189952 missense probably benign 0.03
R1074:Catsperg1 UTSW 7 29206849 missense probably damaging 1.00
R1201:Catsperg1 UTSW 7 29191670 missense possibly damaging 0.77
R1346:Catsperg1 UTSW 7 29182334 splice site probably null
R1387:Catsperg1 UTSW 7 29206864 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1486:Catsperg1 UTSW 7 29185495 missense probably damaging 1.00
R1883:Catsperg1 UTSW 7 29182236 critical splice donor site probably null
R1932:Catsperg1 UTSW 7 29198143 missense probably damaging 1.00
R1942:Catsperg1 UTSW 7 29206807 missense possibly damaging 0.89
R2127:Catsperg1 UTSW 7 29185040 missense probably damaging 1.00
R2205:Catsperg1 UTSW 7 29185246 nonsense probably null
R4214:Catsperg1 UTSW 7 29195932 missense possibly damaging 0.80
R4678:Catsperg1 UTSW 7 29190296 missense probably benign 0.13
R5008:Catsperg1 UTSW 7 29195434 nonsense probably null
R5217:Catsperg1 UTSW 7 29190298 nonsense probably null
R5268:Catsperg1 UTSW 7 29195247 missense probably benign 0.41
R5372:Catsperg1 UTSW 7 29210712 missense probably benign 0.08
R5393:Catsperg1 UTSW 7 29185499 missense probably damaging 1.00
R5406:Catsperg1 UTSW 7 29185523 missense probably damaging 1.00
R5557:Catsperg1 UTSW 7 29195871 missense possibly damaging 0.89
R5921:Catsperg1 UTSW 7 29190523 missense possibly damaging 0.78
R5928:Catsperg1 UTSW 7 29206615 missense probably damaging 0.99
R5960:Catsperg1 UTSW 7 29184783 unclassified probably benign
R6053:Catsperg1 UTSW 7 29210814 nonsense probably null
R6144:Catsperg1 UTSW 7 29210695 missense probably damaging 0.99
R6334:Catsperg1 UTSW 7 29206357 missense probably benign 0.01
R6446:Catsperg1 UTSW 7 29206567 missense probably benign 0.00
R6854:Catsperg1 UTSW 7 29181702 missense possibly damaging 0.72
R7171:Catsperg1 UTSW 7 29185212 missense probably damaging 1.00
R7326:Catsperg1 UTSW 7 29210759 missense possibly damaging 0.82
R7382:Catsperg1 UTSW 7 29204844 missense probably benign 0.02
R7473:Catsperg1 UTSW 7 29195478 missense probably damaging 1.00
R7555:Catsperg1 UTSW 7 29189814 missense probably damaging 0.97
R7714:Catsperg1 UTSW 7 29185482 missense probably null 1.00
R7914:Catsperg1 UTSW 7 29195426 missense probably benign
R7935:Catsperg1 UTSW 7 29195919 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AACTTTGAGCCTGCCACCTC -3'
(R):5'- ACAGGTGTTGTTCTCAAGTCTC -3'

Sequencing Primer
(F):5'- TCTCCTGAGGACACATGGCAAG -3'
(R):5'- GTGTTGTTCTCAAGTCTCCCCAG -3'
Posted On2018-02-27