Incidental Mutation 'R6215:Trim21'
ID503660
Institutional Source Beutler Lab
Gene Symbol Trim21
Ensembl Gene ENSMUSG00000030966
Gene Nametripartite motif-containing 21
SynonymsSsa1, Ro52
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102557921-102565486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102559439 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 358 (S358P)
Ref Sequence ENSEMBL: ENSMUSP00000102526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]
Predicted Effect probably damaging
Transcript: ENSMUST00000033264
AA Change: S358P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966
AA Change: S358P

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098227
SMART Domains Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.7e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 225 1.2e-11 PFAM
Pfam:7tm_1 43 294 1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106913
AA Change: S358P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966
AA Change: S358P

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209907
Predicted Effect probably benign
Transcript: ENSMUST00000217478
Meta Mutation Damage Score 0.4874 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Unmanipulated homozygous mice are normal, but leads to tissue inflammation and systemic autoimmunity in vivo and reduced number of CD11c+ dendritic cells from mutant bone marrow in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Trim21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Trim21 APN 7 102559598 missense probably damaging 1.00
IGL01729:Trim21 APN 7 102563893 missense probably damaging 0.97
IGL02680:Trim21 APN 7 102559663 missense probably benign 0.44
IGL03349:Trim21 APN 7 102563277 missense probably benign 0.00
R1508:Trim21 UTSW 7 102559576 missense possibly damaging 0.52
R1662:Trim21 UTSW 7 102561898 nonsense probably null
R2904:Trim21 UTSW 7 102559971 missense probably benign 0.00
R4482:Trim21 UTSW 7 102563933 nonsense probably null
R5480:Trim21 UTSW 7 102559256 missense probably benign 0.05
R5606:Trim21 UTSW 7 102559606 missense probably damaging 0.99
R6130:Trim21 UTSW 7 102563291 missense possibly damaging 0.95
R6214:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6291:Trim21 UTSW 7 102564082 missense probably damaging 1.00
R6731:Trim21 UTSW 7 102559212 missense probably damaging 1.00
R7612:Trim21 UTSW 7 102559535 missense probably benign 0.01
R8008:Trim21 UTSW 7 102559976 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGCCATGGTCAGTTATG -3'
(R):5'- ATTACTCTGGATCGCAACACCG -3'

Sequencing Primer
(F):5'- AGCCATGGTCAGTTATGTTGTAGAAG -3'
(R):5'- TGGCTCATCATCTCAAAGGATCGG -3'
Posted On2018-02-27