Mutagenetix > Incidental Mutations

Incidental Mutation 'R6215:Dmbt1'

503661

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin

MMRRC Submission

044348-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.297) question?

Stock #

R6215 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

131032053-131121630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 131066733 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 573 (C573F)

Ref Sequence

ENSEMBL: ENSMUSP00000146685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084509
AA Change: C562F

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: C562F

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208311
AA Change: C573F

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000213064

Meta Mutation Damage Score

0.9300

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

95% (42/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,291,112	K2021N	probably benign	Het
Adgrv1	C	T	13: 81,579,594	W309*	probably null	Het
Aox1	G	A	1: 58,085,461	V954I	probably benign	Het
Asnsd1	A	C	1: 53,348,028		probably null	Het
Aste1	A	G	9: 105,396,857	K38E	probably damaging	Het
Catsperg1	A	G	7: 29,200,239	V339A	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cd79b	C	A	11: 106,312,441		probably null	Het
Chd3	A	G	11: 69,356,554	L981P	probably damaging	Het
Chia1	T	C	3: 106,122,445	F132L	probably damaging	Het
Dhx9	G	A	1: 153,472,463	P336S	probably damaging	Het
Dido1	T	C	2: 180,662,152	K1320E	probably damaging	Het
Dmtn	A	G	14: 70,613,336	I205T	probably benign	Het
Efnb3	C	A	11: 69,556,765	V181L	probably benign	Het
Flg2	G	T	3: 93,201,859	C398F	possibly damaging	Het
Gabbr1	A	G	17: 37,069,365	D604G	probably damaging	Het
Glis2	T	A	16: 4,610,333	L83*	probably null	Het
Gm10719	T	A	9: 3,019,040		probably null	Homo
Gm8890	C	T	5: 11,257,230	T25I	probably damaging	Het
Hipk3	T	C	2: 104,433,741	D804G	probably damaging	Het
Kcnd1	G	C	X: 7,823,909	A23P	probably damaging	Homo
Kcnj13	A	G	1: 87,386,534	V322A	probably benign	Het
Nav3	A	G	10: 109,852,565	L617P	probably damaging	Het
Npc1	ACAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAG	18: 12,236,192		probably benign	Het
Olfr918	A	G	9: 38,673,214	S90P	probably benign	Het
Osgin1	G	A	8: 119,445,444	V326I	probably benign	Het
Pcsk7	A	C	9: 45,910,376	N156T	possibly damaging	Het
Pde4d	C	T	13: 109,949,433	S515L	probably damaging	Het
Peg10	GC	GCCCC	6: 4,756,452		probably benign	Het
Ppp2r5a	T	A	1: 191,362,250	Q191L	probably benign	Het
Prom2	A	G	2: 127,539,775		probably null	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Sart3	C	T	5: 113,743,206	A938T	probably benign	Het
Scn3a	T	C	2: 65,495,036	I1046V	probably benign	Het
Sh3glb2	T	C	2: 30,345,793	E313G	possibly damaging	Het
Slc13a1	A	T	6: 24,090,796	Y541*	probably null	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Tm6sf2	T	C	8: 70,073,074	V27A	possibly damaging	Het
Tmem116	C	T	5: 121,491,108	T188M	probably benign	Het
Tmem2	C	A	19: 21,812,387	N650K	probably benign	Het
Trim21	A	G	7: 102,559,439	S358P	probably damaging	Het
Ttc21a	A	G	9: 119,966,772	Y1224C	probably damaging	Het
Ttn	T	A	2: 76,880,208		probably benign	Het
Vmn2r99	A	G	17: 19,382,558	Q525R	probably benign	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	131079540	intron	probably benign
IGL00161:Dmbt1	APN	7	131109628	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	131099290	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	131082500	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	131097607	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	131058158	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	131085368	splice site	probably benign
IGL01317:Dmbt1	APN	7	131041191	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	131088767	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	131103679	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	131116728	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	131081185	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	131074419	intron	probably benign
IGL02160:Dmbt1	APN	7	131082688	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	131093256	splice site	probably benign
IGL02197:Dmbt1	APN	7	131085422	splice site	probably benign
IGL02332:Dmbt1	APN	7	131066613	intron	probably benign
IGL02427:Dmbt1	APN	7	131088085	splice site	probably null
IGL02726:Dmbt1	APN	7	131074410	intron	probably benign
IGL02967:Dmbt1	APN	7	131071189	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	131082679	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	131111049	missense	probably damaging	0.99
BB005:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	131112076	nonsense	probably null
K3955:Dmbt1	UTSW	7	131119564	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	131119496	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	131106393	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	131096049	splice site	probably benign
R0427:Dmbt1	UTSW	7	131040902	nonsense	probably null
R0478:Dmbt1	UTSW	7	131041187	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	131097673	splice site	probably null
R0538:Dmbt1	UTSW	7	131049901	splice site	probably benign
R0626:Dmbt1	UTSW	7	131102081	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	131097653	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	131093117	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	131074524	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	131050214	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	131044487	splice site	probably benign
R1463:Dmbt1	UTSW	7	131109637	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	131074331	intron	probably benign
R1990:Dmbt1	UTSW	7	131058288	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	131110989	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	131106359	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	131106170	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	131099133	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	131050018	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	131102032	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	131097575	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	131046562	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	131090494	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	131106468	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	131094734	nonsense	probably null
R3014:Dmbt1	UTSW	7	131032097	intron	probably benign
R3155:Dmbt1	UTSW	7	131050157	nonsense	probably null
R3176:Dmbt1	UTSW	7	131088071	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	131088071	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	131106249	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	131112090	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	131074202	intron	probably benign
R4396:Dmbt1	UTSW	7	131116632	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	131040934	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	131050012	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	131094742	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	131097670	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	131094735	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	131082619	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	131041021	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	131119511	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	131040993	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	131063403	intron	probably benign
R5526:Dmbt1	UTSW	7	131041190	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	131099300	nonsense	probably null
R5566:Dmbt1	UTSW	7	131106273	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	131054067	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	131109641	splice site	probably null
R6188:Dmbt1	UTSW	7	131097631	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	131066733	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	131058254	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	131103578	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	131116641	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	131046510	splice site	probably null
R6719:Dmbt1	UTSW	7	131119603	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	131046561	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	131066734	nonsense	probably null
R7191:Dmbt1	UTSW	7	131044520	missense	unknown
R7269:Dmbt1	UTSW	7	131066621	missense	unknown
R7288:Dmbt1	UTSW	7	131083789	nonsense	probably null
R7296:Dmbt1	UTSW	7	131112132	missense	unknown
R7349:Dmbt1	UTSW	7	131041124	missense	unknown
R7386:Dmbt1	UTSW	7	131112236	missense	unknown
R7428:Dmbt1	UTSW	7	131108463	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	131079511	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	131066462	missense	unknown
R7513:Dmbt1	UTSW	7	131090512	missense	unknown
R7553:Dmbt1	UTSW	7	131104867	missense	unknown
R7567:Dmbt1	UTSW	7	131061363	splice site	probably null
R7584:Dmbt1	UTSW	7	131088751	nonsense	probably null
R7736:Dmbt1	UTSW	7	131116896	missense	unknown
R7758:Dmbt1	UTSW	7	131121197	missense	unknown
R7928:Dmbt1	UTSW	7	131037890	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	131088770	missense	unknown
R8098:Dmbt1	UTSW	7	131108459	nonsense	probably null
R8125:Dmbt1	UTSW	7	131099223	missense	unknown
R8177:Dmbt1	UTSW	7	131106432	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	131085417	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	131066600	missense	unknown
R8378:Dmbt1	UTSW	7	131106465	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	131082587	missense	unknown
R8400:Dmbt1	UTSW	7	131082587	missense	unknown
R8445:Dmbt1	UTSW	7	131090380	missense	unknown
R8450:Dmbt1	UTSW	7	131085417	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	131102012	missense	unknown
X0024:Dmbt1	UTSW	7	131112248	nonsense	probably null
X0062:Dmbt1	UTSW	7	131094851	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	131088812	missense	unknown
Z1177:Dmbt1	UTSW	7	131082485	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AATGATGCCAACGTGGTGTG -3'
(R):5'- CTTGACACTGCATTTCTATGGC -3'

Sequencing Primer
(F):5'- CAACGTGGTGTGCAGGCAG -3'
(R):5'- TCAAGCCTCACTAGAGACTGAGAG -3'

Posted On

2018-02-27