Incidental Mutation 'R6215:Osgin1'
ID503663
Institutional Source Beutler Lab
Gene Symbol Osgin1
Ensembl Gene ENSMUSG00000074063
Gene Nameoxidative stress induced growth inhibitor 1
Synonyms1700012B18Rik
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location119434124-119446256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119445444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 326 (V326I)
Ref Sequence ENSEMBL: ENSMUSP00000114467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098363] [ENSMUST00000098365] [ENSMUST00000131448] [ENSMUST00000152420] [ENSMUST00000212112]
Predicted Effect probably benign
Transcript: ENSMUST00000098363
SMART Domains Protein: ENSMUSP00000095966
Gene: ENSMUSG00000031837

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
EFh 67 95 4.06e-2 SMART
EFh 101 129 3.21e0 SMART
low complexity region 185 196 N/A INTRINSIC
Pfam:ABM 289 363 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126414
Predicted Effect probably benign
Transcript: ENSMUST00000131448
SMART Domains Protein: ENSMUSP00000120477
Gene: ENSMUSG00000074063

DomainStartEndE-ValueType
SCOP:d1foha5 12 38 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145604
Predicted Effect probably benign
Transcript: ENSMUST00000152420
AA Change: V326I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114467
Gene: ENSMUSG00000074063
AA Change: V326I

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 205 465 3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212112
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an oxidative stress response protein that regulates cell death. Expression of the gene is regulated by p53 and is induced by DNA damage. The protein regulates apoptosis by inducing cytochrome c release from mitochondria. It also appears to be a key regulator of both inflammatory and anti-inflammatory molecules. The loss of this protein correlates with uncontrolled cell growth and tumor formation. Naturally occurring read-through transcription exists between this gene and the neighboring upstream malonyl-CoA decarboxylase (MLYCD) gene, but the read-through transcripts are unlikely to produce a protein product. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Osgin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Osgin1 APN 8 119445046 missense probably damaging 0.97
IGL02347:Osgin1 APN 8 119445538 missense probably benign 0.02
IGL02803:Osgin1 APN 8 119443267 missense probably benign 0.00
IGL03111:Osgin1 APN 8 119443049 missense probably damaging 0.96
R0137:Osgin1 UTSW 8 119442480 missense possibly damaging 0.73
R0265:Osgin1 UTSW 8 119445657 missense possibly damaging 0.94
R0520:Osgin1 UTSW 8 119442508 missense probably damaging 1.00
R0650:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0652:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0687:Osgin1 UTSW 8 119445832 missense probably damaging 1.00
R1439:Osgin1 UTSW 8 119443113 splice site probably null
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R2058:Osgin1 UTSW 8 119445673 missense possibly damaging 0.87
R2982:Osgin1 UTSW 8 119442535 missense probably damaging 1.00
R3880:Osgin1 UTSW 8 119441452 missense probably benign
R4076:Osgin1 UTSW 8 119445033 missense possibly damaging 0.64
R4594:Osgin1 UTSW 8 119445253 missense possibly damaging 0.49
R4914:Osgin1 UTSW 8 119442544 missense possibly damaging 0.91
R4991:Osgin1 UTSW 8 119445289 missense probably damaging 1.00
R5689:Osgin1 UTSW 8 119444989 makesense probably null
R7008:Osgin1 UTSW 8 119441494 missense possibly damaging 0.92
R7136:Osgin1 UTSW 8 119441437 start codon destroyed probably null 0.51
R7380:Osgin1 UTSW 8 119445431 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGTGAATGGCTACTTGACTACC -3'
(R):5'- CAATGAGGACCAGCACCATG -3'

Sequencing Primer
(F):5'- TTTGACAGCCCAGCCATG -3'
(R):5'- GAGACCCCAAAGAGCTGCTG -3'
Posted On2018-02-27