Incidental Mutation 'R6215:Aste1'
ID503666
Institutional Source Beutler Lab
Gene Symbol Aste1
Ensembl Gene ENSMUSG00000032567
Gene Nameasteroid homolog 1
Synonyms1100001A21Rik
MMRRC Submission 044348-MU
Accession Numbers

Ncbi RefSeq: NM_025651.4, NM_001164828.1; MGI:1913845

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location105395392-105412229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105396857 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 38 (K38E)
Ref Sequence ENSEMBL: ENSMUSP00000149596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000038648] [ENSMUST00000123807] [ENSMUST00000140851] [ENSMUST00000156256] [ENSMUST00000167674] [ENSMUST00000176350] [ENSMUST00000176940] [ENSMUST00000177029] [ENSMUST00000177402] [ENSMUST00000189758]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035181
AA Change: K99E

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567
AA Change: K99E

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038648
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123807
AA Change: K38E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000123807
AA Change: K38E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137208
Predicted Effect probably benign
Transcript: ENSMUST00000140851
SMART Domains Protein: ENSMUSP00000116864
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156256
SMART Domains Protein: ENSMUSP00000116761
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
Pfam:Pkinase 30 177 8.9e-36 PFAM
Pfam:Pkinase_Tyr 30 178 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167674
SMART Domains Protein: ENSMUSP00000131164
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176597
Predicted Effect possibly damaging
Transcript: ENSMUST00000176940
AA Change: K99E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000177029
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Meta Mutation Damage Score 0.2158 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
Allele List at MGI

All alleles(6) : Targeted(4) Gene trapped(2)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Aste1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Aste1 APN 9 105397844 missense probably damaging 0.99
IGL03161:Aste1 APN 9 105396672 missense probably damaging 1.00
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R0022:Aste1 UTSW 9 105396624 nonsense probably null
R1485:Aste1 UTSW 9 105397810 nonsense probably null
R2010:Aste1 UTSW 9 105403502 missense probably damaging 1.00
R5048:Aste1 UTSW 9 105396989 missense probably damaging 1.00
R5084:Aste1 UTSW 9 105397687 nonsense probably null
R5091:Aste1 UTSW 9 105405004 missense probably damaging 1.00
R5197:Aste1 UTSW 9 105405054 missense probably damaging 1.00
R5294:Aste1 UTSW 9 105402705 splice site probably null
R5617:Aste1 UTSW 9 105397835 missense probably benign 0.00
R5834:Aste1 UTSW 9 105403415 missense probably benign 0.01
R6214:Aste1 UTSW 9 105396857 missense probably damaging 0.96
R6249:Aste1 UTSW 9 105396617 missense probably benign 0.00
R6913:Aste1 UTSW 9 105397408 missense probably benign 0.01
R7069:Aste1 UTSW 9 105396707 critical splice donor site probably null
R7155:Aste1 UTSW 9 105405136 missense probably damaging 1.00
R7360:Aste1 UTSW 9 105397636 missense probably damaging 0.97
R7488:Aste1 UTSW 9 105402705 splice site probably null
R7588:Aste1 UTSW 9 105397391 missense possibly damaging 0.73
R7734:Aste1 UTSW 9 105397479 missense probably damaging 0.99
R8358:Aste1 UTSW 9 105397056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTCTGACTTGGAGCTCAGG -3'
(R):5'- TTCAGTGAGCAAAACCCACTTC -3'

Sequencing Primer
(F):5'- AATTCTGACTTGGAGCTCAGGTATGG -3'
(R):5'- TATCCGATGATAGCACAGGACAATTC -3'
Posted On2018-02-27