Incidental Mutation 'R6215:Efnb3'
ID503672
Institutional Source Beutler Lab
Gene Symbol Efnb3
Ensembl Gene ENSMUSG00000003934
Gene Nameephrin B3
SynonymsEpl8, EFL-6, Elk-L3, ELF-3, LERK-8, NLERK-2
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69554092-69560205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69556765 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 181 (V181L)
Ref Sequence ENSEMBL: ENSMUSP00000004036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004036] [ENSMUST00000048139]
PDB Structure
Crystal Structures of Nipah Virus G Attachment Glycoprotein in Complex with its Receptor Ephrin-B3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000004036
AA Change: V181L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000004036
Gene: ENSMUSG00000003934
AA Change: V181L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Ephrin 28 167 2.8e-45 PFAM
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 264 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048139
SMART Domains Protein: ENSMUSP00000047825
Gene: ENSMUSG00000041346

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
WD40 144 181 5.75e-1 SMART
Blast:WD40 197 242 3e-18 BLAST
WD40 245 288 1.67e-1 SMART
WD40 295 337 3.58e-1 SMART
WD40 340 380 1.19e-6 SMART
WD40 384 425 8.25e0 SMART
Blast:WD40 435 471 1e-14 BLAST
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155894
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EFNB3, a member of the ephrin gene family, is important in brain development as well as in its maintenance. Moreover, since levels of EFNB3 expression were particularly high in several forebrain subregions compared to other brain subregions, it may play a pivotal role in forebrain function. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH Receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit a hopping gait due to corticospinal tract defects, mutations that remove only the cytoplasmic domain of the protein do not result in the gait or CNS phenotypes, and a G244E mutation causes ataxia [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Efnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Efnb3 APN 11 69556904 critical splice donor site probably null
IGL03114:Efnb3 APN 11 69556802 unclassified probably benign
IGL03328:Efnb3 APN 11 69557205 missense probably damaging 1.00
turtle UTSW 11 69557283 missense probably damaging 1.00
R0621:Efnb3 UTSW 11 69555972 missense probably damaging 1.00
R4366:Efnb3 UTSW 11 69555945 missense probably damaging 1.00
R6356:Efnb3 UTSW 11 69556140 missense probably benign 0.01
R7638:Efnb3 UTSW 11 69557220 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCAGTGACTTGGCTAATTAGTTC -3'
(R):5'- CATGAAGGTGCTTCTGCGAG -3'

Sequencing Primer
(F):5'- TGTATAGCCGCCCCCAAAG -3'
(R):5'- CTTCTGCGAGTGGGACAAAGTG -3'
Posted On2018-02-27