Incidental Mutation 'R6215:Smtnl2'
ID503673
Institutional Source Beutler Lab
Gene Symbol Smtnl2
Ensembl Gene ENSMUSG00000045667
Gene Namesmoothelin-like 2
SynonymsD130058I21Rik
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72389164-72411713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72401399 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 274 (A274V)
Ref Sequence ENSEMBL: ENSMUSP00000104140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050226] [ENSMUST00000108500]
Predicted Effect probably damaging
Transcript: ENSMUST00000050226
AA Change: A308V

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059043
Gene: ENSMUSG00000045667
AA Change: A308V

DomainStartEndE-ValueType
coiled coil region 55 88 N/A INTRINSIC
low complexity region 176 181 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 242 252 N/A INTRINSIC
low complexity region 265 287 N/A INTRINSIC
CH 348 448 3.16e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108500
AA Change: A274V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104140
Gene: ENSMUSG00000045667
AA Change: A274V

DomainStartEndE-ValueType
coiled coil region 21 54 N/A INTRINSIC
low complexity region 142 147 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 231 253 N/A INTRINSIC
CH 314 414 3.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143345
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Smtnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Smtnl2 APN 11 72403259 splice site probably benign
IGL00948:Smtnl2 APN 11 72411241 splice site probably null
IGL01310:Smtnl2 APN 11 72401345 splice site probably null
IGL02277:Smtnl2 APN 11 72391373 missense probably damaging 0.99
R0508:Smtnl2 UTSW 11 72403136 missense probably damaging 1.00
R0784:Smtnl2 UTSW 11 72399937 missense probably damaging 1.00
R1418:Smtnl2 UTSW 11 72401421 missense probably damaging 0.97
R1971:Smtnl2 UTSW 11 72411357 missense probably benign 0.00
R5094:Smtnl2 UTSW 11 72400385 missense probably damaging 1.00
R5270:Smtnl2 UTSW 11 72399917 missense probably benign 0.00
R5518:Smtnl2 UTSW 11 72401516 missense possibly damaging 0.95
R5965:Smtnl2 UTSW 11 72400453 splice site probably null
R6213:Smtnl2 UTSW 11 72401399 missense probably damaging 1.00
R6255:Smtnl2 UTSW 11 72401399 missense probably damaging 1.00
R6257:Smtnl2 UTSW 11 72401399 missense probably damaging 1.00
R6580:Smtnl2 UTSW 11 72403033 missense probably benign 0.12
R7996:Smtnl2 UTSW 11 72400374 missense probably damaging 1.00
R8392:Smtnl2 UTSW 11 72403167 missense probably benign
Z1176:Smtnl2 UTSW 11 72411711 utr 5 prime probably benign
Z1177:Smtnl2 UTSW 11 72401481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGAGAAATCTGATCTTGGG -3'
(R):5'- TATAAGCTGTCTGCCTCGCTG -3'

Sequencing Primer
(F):5'- TCTGATCTTGGGAAACAGTCAG -3'
(R):5'- ACTCAGGGTGGGCGTTTCAC -3'
Posted On2018-02-27