Incidental Mutation 'R6215:Dmtn'
ID503677
Institutional Source Beutler Lab
Gene Symbol Dmtn
Ensembl Gene ENSMUSG00000022099
Gene Namedematin actin binding protein
SynonymsEpb4.9, dematin
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70601263-70636048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70613336 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 205 (I205T)
Ref Sequence ENSEMBL: ENSMUSP00000154373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000226543] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228009] [ENSMUST00000228295] [ENSMUST00000228824]
Predicted Effect probably benign
Transcript: ENSMUST00000022694
AA Change: I230T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: I230T

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 8 93 8e-30 PFAM
Pfam:AbLIM_anchor 79 347 1.9e-58 PFAM
VHP 348 383 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022695
AA Change: I205T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099
AA Change: I205T

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
coiled coil region 188 220 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
VHP 345 380 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110984
AA Change: I230T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: I230T

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 213 245 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
VHP 348 383 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226543
Predicted Effect probably benign
Transcript: ENSMUST00000227331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227453
Predicted Effect probably benign
Transcript: ENSMUST00000228001
AA Change: I205T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000228009
AA Change: I230T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228295
AA Change: I205T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000228824
AA Change: I205T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Dmtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Dmtn APN 14 70604819 missense probably damaging 1.00
IGL02836:Dmtn APN 14 70616078 missense probably damaging 1.00
R1248:Dmtn UTSW 14 70612658 splice site probably benign
R2428:Dmtn UTSW 14 70613403 missense probably damaging 1.00
R3438:Dmtn UTSW 14 70612716 missense probably damaging 0.98
R4851:Dmtn UTSW 14 70604814 missense probably damaging 1.00
R4917:Dmtn UTSW 14 70605719 missense probably damaging 0.98
R4924:Dmtn UTSW 14 70617959 missense probably benign 0.25
R5633:Dmtn UTSW 14 70604979 missense probably benign 0.18
R6170:Dmtn UTSW 14 70617355 missense probably damaging 1.00
R6214:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6639:Dmtn UTSW 14 70617430 missense probably damaging 1.00
R6860:Dmtn UTSW 14 70614882 missense possibly damaging 0.94
R7139:Dmtn UTSW 14 70617427 missense probably benign 0.12
R7242:Dmtn UTSW 14 70618020 missense probably damaging 1.00
R7380:Dmtn UTSW 14 70617328 missense probably damaging 0.99
R7572:Dmtn UTSW 14 70605337 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTAATGTCCAGGACCACTGTTCC -3'
(R):5'- AGACAGACTTTGTTCCAGCC -3'

Sequencing Primer
(F):5'- TCCTGGTAAAGAAGAGGCACCTC -3'
(R):5'- AGCCCTGTTCCACAAGCTG -3'
Posted On2018-02-27