Incidental Mutation 'R6215:Gabbr1'
ID503680
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R6215 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37069365 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 604 (D604G)
Ref Sequence ENSEMBL: ENSMUSP00000134268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823]
Predicted Effect probably damaging
Transcript: ENSMUST00000025338
AA Change: D720G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: D720G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172792
AA Change: D604G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: D604G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174181
Meta Mutation Damage Score 0.9416 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 splice site probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1612:Gabbr1 UTSW 17 37070669 missense probably damaging 1.00
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4299:Gabbr1 UTSW 17 37055900 nonsense probably null
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4510:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5227:Gabbr1 UTSW 17 37070066 missense possibly damaging 0.93
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5485:Gabbr1 UTSW 17 37056875 missense possibly damaging 0.83
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R5976:Gabbr1 UTSW 17 37067862 missense probably damaging 1.00
R6156:Gabbr1 UTSW 17 37048427 missense probably benign 0.01
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
R7317:Gabbr1 UTSW 17 37069413 missense probably damaging 1.00
R7786:Gabbr1 UTSW 17 37070063 missense probably damaging 0.98
R7793:Gabbr1 UTSW 17 37047501 missense probably benign 0.13
R7833:Gabbr1 UTSW 17 37056969 missense possibly damaging 0.88
R8110:Gabbr1 UTSW 17 37048583 missense probably benign 0.10
R8318:Gabbr1 UTSW 17 37062543 missense probably benign 0.23
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Z1177:Gabbr1 UTSW 17 37048424 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GGTCCACACAGTCTTCACAAAG -3'
(R):5'- AGTTCTCTCCTGGAGCAGCTTC -3'

Sequencing Primer
(F):5'- TTCACAAAGAAGGAGGAGAAGAAG -3'
(R):5'- GGCCTGGAACTCATCATGTAGAC -3'
Posted On2018-02-27