Incidental Mutation 'R6215:Kcnd1'
ID503683
Institutional Source Beutler Lab
Gene Symbol Kcnd1
Ensembl Gene ENSMUSG00000009731
Gene Namepotassium voltage-gated channel, Shal-related family, member 1
Synonyms1110037K09Rik, mShal1, Shal, Kv4.1, Kca2-1
MMRRC Submission 044348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6215 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location7822289-7838280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 7823909 bp
ZygosityHomozygous
Amino Acid Change Alanine to Proline at position 23 (A23P)
Ref Sequence ENSEMBL: ENSMUSP00000009875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009875] [ENSMUST00000065932] [ENSMUST00000101694] [ENSMUST00000115675]
Predicted Effect probably damaging
Transcript: ENSMUST00000009875
AA Change: A23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009875
Gene: ENSMUSG00000009731
AA Change: A23P

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 3.1e-16 PFAM
BTB 40 139 2.4e-18 SMART
low complexity region 147 165 N/A INTRINSIC
Pfam:Ion_trans 185 419 3.5e-46 PFAM
Pfam:Ion_trans_2 332 413 2e-14 PFAM
Pfam:DUF3399 447 550 3.4e-40 PFAM
low complexity region 614 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065932
SMART Domains Protein: ENSMUSP00000068789
Gene: ENSMUSG00000031153

DomainStartEndE-ValueType
coiled coil region 4 33 N/A INTRINSIC
coiled coil region 61 158 N/A INTRINSIC
coiled coil region 204 606 N/A INTRINSIC
coiled coil region 666 700 N/A INTRINSIC
Blast:BTB 724 776 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000101694
SMART Domains Protein: ENSMUSP00000099218
Gene: ENSMUSG00000031153

DomainStartEndE-ValueType
coiled coil region 4 113 N/A INTRINSIC
coiled coil region 159 592 N/A INTRINSIC
coiled coil region 652 686 N/A INTRINSIC
Blast:BTB 710 762 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115675
SMART Domains Protein: ENSMUSP00000111339
Gene: ENSMUSG00000031153

DomainStartEndE-ValueType
coiled coil region 4 33 N/A INTRINSIC
coiled coil region 61 158 N/A INTRINSIC
coiled coil region 204 637 N/A INTRINSIC
coiled coil region 697 731 N/A INTRINSIC
Blast:BTB 755 807 2e-27 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144946
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: This gene encodes a multipass transmembrane protein that comprises a subunit of voltage-gated rapidly inactivating A-type potassium channels. [provided by RefSeq, May 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,291,112 K2021N probably benign Het
Adgrv1 C T 13: 81,579,594 W309* probably null Het
Aox1 G A 1: 58,085,461 V954I probably benign Het
Asnsd1 A C 1: 53,348,028 probably null Het
Aste1 A G 9: 105,396,857 K38E probably damaging Het
Catsperg1 A G 7: 29,200,239 V339A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cd79b C A 11: 106,312,441 probably null Het
Chd3 A G 11: 69,356,554 L981P probably damaging Het
Chia1 T C 3: 106,122,445 F132L probably damaging Het
Dhx9 G A 1: 153,472,463 P336S probably damaging Het
Dido1 T C 2: 180,662,152 K1320E probably damaging Het
Dmbt1 G T 7: 131,066,733 C573F possibly damaging Het
Dmtn A G 14: 70,613,336 I205T probably benign Het
Efnb3 C A 11: 69,556,765 V181L probably benign Het
Flg2 G T 3: 93,201,859 C398F possibly damaging Het
Gabbr1 A G 17: 37,069,365 D604G probably damaging Het
Glis2 T A 16: 4,610,333 L83* probably null Het
Gm10719 T A 9: 3,019,040 probably null Homo
Gm8890 C T 5: 11,257,230 T25I probably damaging Het
Hipk3 T C 2: 104,433,741 D804G probably damaging Het
Kcnj13 A G 1: 87,386,534 V322A probably benign Het
Nav3 A G 10: 109,852,565 L617P probably damaging Het
Npc1 ACAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAG 18: 12,236,192 probably benign Het
Olfr918 A G 9: 38,673,214 S90P probably benign Het
Osgin1 G A 8: 119,445,444 V326I probably benign Het
Pcsk7 A C 9: 45,910,376 N156T possibly damaging Het
Pde4d C T 13: 109,949,433 S515L probably damaging Het
Peg10 GC GCCCC 6: 4,756,452 probably benign Het
Ppp2r5a T A 1: 191,362,250 Q191L probably benign Het
Prom2 A G 2: 127,539,775 probably null Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Scn3a T C 2: 65,495,036 I1046V probably benign Het
Sh3glb2 T C 2: 30,345,793 E313G possibly damaging Het
Slc13a1 A T 6: 24,090,796 Y541* probably null Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Tm6sf2 T C 8: 70,073,074 V27A possibly damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem2 C A 19: 21,812,387 N650K probably benign Het
Trim21 A G 7: 102,559,439 S358P probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Ttn T A 2: 76,880,208 probably benign Het
Vmn2r99 A G 17: 19,382,558 Q525R probably benign Het
Other mutations in Kcnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Kcnd1 APN X 7836433 missense probably benign
R0437:Kcnd1 UTSW X 7824683 missense probably benign
R0479:Kcnd1 UTSW X 7831222 missense possibly damaging 0.88
R2264:Kcnd1 UTSW X 7824084 splice site probably null
R6213:Kcnd1 UTSW X 7823909 missense probably damaging 1.00
R6214:Kcnd1 UTSW X 7823909 missense probably damaging 1.00
R6216:Kcnd1 UTSW X 7823909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCTTAGAAAGCTCCCC -3'
(R):5'- AGTACTCGCCAGATTCAGCATC -3'

Sequencing Primer
(F):5'- CAAGCCCCCTAAGTTCCTG -3'
(R):5'- TCGCCAGATTCAGCATCATAGAAG -3'
Posted On2018-02-27