Incidental Mutation 'R6216:Terf1'
ID503684
Institutional Source Beutler Lab
Gene Symbol Terf1
Ensembl Gene ENSMUSG00000025925
Gene Nametelomeric repeat binding factor 1
SynonymsTrbf1, Trf1, Pin2
MMRRC Submission 044349-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6216 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location15805646-15844052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15818997 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 188 (H188Y)
Ref Sequence ENSEMBL: ENSMUSP00000027057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027057] [ENSMUST00000188371]
Predicted Effect probably benign
Transcript: ENSMUST00000027057
AA Change: H188Y

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027057
Gene: ENSMUSG00000025925
AA Change: H188Y

DomainStartEndE-ValueType
Pfam:TRF 61 257 2.3e-28 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186565
Predicted Effect probably benign
Transcript: ENSMUST00000188371
AA Change: H217Y

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140744
Gene: ENSMUSG00000025925
AA Change: H217Y

DomainStartEndE-ValueType
Pfam:TRF 61 258 3e-30 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188684
Meta Mutation Damage Score 0.4537 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes a protein that binds to repeats in telomeres to form a nucleoprotein complex that protects against the degradation of chromosomal ends. The encoded protein regulates the length of telomeres and is an integral structural component of the functional telomere. This protein is thought to play a role in spindle formation in mitosis. Mutations in this gene are associated with bone marrow failure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality and die sometime before E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,627 D488G probably benign Het
Adgrv1 C A 13: 81,524,471 probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh3 G A 2: 94,008,536 probably benign Het
Ankrd22 A T 19: 34,124,169 probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arid2 A G 15: 96,356,909 D212G probably benign Het
Bbx A T 16: 50,251,388 S225T probably benign Het
Bivm T A 1: 44,126,868 probably null Het
Bpifb3 A G 2: 153,925,853 Y282C probably benign Het
Cacna1h A T 17: 25,378,819 I1767N probably damaging Het
Ccdc28a G T 10: 18,224,971 S36* probably null Het
Ccser2 A G 14: 36,940,508 S240P probably damaging Het
Ceacam1 A T 7: 25,471,996 S348T probably benign Het
Ddx49 C T 8: 70,297,284 G161D probably damaging Het
Dhx16 A G 17: 35,882,972 E353G possibly damaging Het
Etv2 A G 7: 30,634,611 probably null Het
Extl1 T C 4: 134,363,130 T345A probably benign Het
Fam163a A T 1: 156,078,995 S137T probably benign Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fsd1l T C 4: 53,694,742 C388R probably damaging Het
Galnt18 A C 7: 111,513,550 V470G probably benign Het
Grin2b T A 6: 135,772,399 I602F probably damaging Het
Gucy1b1 G T 3: 82,046,713 probably null Het
Hace1 T C 10: 45,618,547 V151A probably benign Het
Hadhb T A 5: 30,174,931 D258E probably benign Het
Heatr1 C T 13: 12,432,664 T1746I probably benign Het
Hrnr T C 3: 93,332,162 S3236P unknown Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kiz C A 2: 146,889,497 D302E probably damaging Het
Kng2 A T 16: 22,987,593 W619R probably damaging Het
Mfap3l C A 8: 60,671,807 T361K probably damaging Het
Mlec T C 5: 115,150,317 H160R probably benign Het
Myo16 T C 8: 10,315,494 L89P probably benign Het
Neb T C 2: 52,224,552 I4232V probably benign Het
Nf1 A G 11: 79,411,607 I334V possibly damaging Het
Nipbl A C 15: 8,318,383 F1942V probably damaging Het
Olfr1205 T C 2: 88,831,311 S65P probably damaging Het
Olfr1242 C A 2: 89,493,722 V197F probably damaging Het
Olfr642 A G 7: 104,049,695 Y220H probably damaging Het
Olfr699 A T 7: 106,790,458 I181N probably benign Het
Pabpc2 G T 18: 39,774,719 A346S probably damaging Het
Paxip1 T C 5: 27,766,173 T393A unknown Het
Pcdhgb5 A T 18: 37,731,928 T259S probably benign Het
Pfkp A T 13: 6,619,188 L253H probably benign Het
Piezo1 T C 8: 122,489,130 D1428G probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pkd1l2 T G 8: 117,081,470 D105A probably damaging Het
Pou2f1 G T 1: 165,880,320 probably benign Het
Ppfia4 T C 1: 134,329,183 E100G probably damaging Het
Ppp1r15a G T 7: 45,524,022 T454K probably damaging Het
Prpsap1 A T 11: 116,471,413 I381N probably damaging Het
Ptx3 T A 3: 66,224,844 V262E probably damaging Het
Rab21 A T 10: 115,294,926 H158Q probably benign Het
Rasa2 A G 9: 96,544,304 S830P probably damaging Het
Rdh1 G A 10: 127,764,753 S215N probably benign Het
Rhot1 G A 11: 80,251,059 R463H probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Selenom A T 11: 3,514,915 probably benign Het
Selenop T C 15: 3,279,465 C300R probably damaging Het
Skint1 T A 4: 112,021,482 S204T probably benign Het
Ss18l1 A G 2: 180,061,913 N313S unknown Het
Sycp2l A G 13: 41,141,724 D289G probably damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Trdn A G 10: 33,305,069 T357A probably damaging Het
Trip11 A C 12: 101,890,600 M401R probably benign Het
Ubald2 A C 11: 116,434,385 D26A probably benign Het
Ube2w C G 1: 16,619,284 probably benign Het
Vmn2r101 T A 17: 19,591,005 S450R probably benign Het
Other mutations in Terf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Terf1 APN 1 15833402 missense probably damaging 1.00
R0358:Terf1 UTSW 1 15805838 missense possibly damaging 0.84
R0369:Terf1 UTSW 1 15818983 missense probably damaging 1.00
R1471:Terf1 UTSW 1 15842970 missense probably damaging 1.00
R1853:Terf1 UTSW 1 15818938 nonsense probably null
R1942:Terf1 UTSW 1 15805814 missense probably benign 0.34
R2029:Terf1 UTSW 1 15805946 missense possibly damaging 0.82
R2132:Terf1 UTSW 1 15805685 missense probably benign 0.02
R2391:Terf1 UTSW 1 15805739 nonsense probably null
R4255:Terf1 UTSW 1 15805679 start codon destroyed probably null 1.00
R4685:Terf1 UTSW 1 15818961 missense possibly damaging 0.80
R5291:Terf1 UTSW 1 15819086 splice site probably null
R5310:Terf1 UTSW 1 15805685 missense probably damaging 0.97
R5338:Terf1 UTSW 1 15831563 missense possibly damaging 0.48
R5661:Terf1 UTSW 1 15819664 missense probably damaging 1.00
R6719:Terf1 UTSW 1 15838236 missense probably benign 0.01
R7126:Terf1 UTSW 1 15813139 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGTCTGAAACAAAATGTCGGG -3'
(R):5'- TGATAGATACAATGCTCTCTAGGC -3'

Sequencing Primer
(F):5'- GCATTAAAGAAGACAATACGTGTGTC -3'
(R):5'- GATCAGAGTTTAGTTCCCAGGTCC -3'
Posted On2018-02-27