Incidental Mutation 'R6216:Ppfia4'
ID503688
Institutional Source Beutler Lab
Gene Symbol Ppfia4
Ensembl Gene ENSMUSG00000026458
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
MMRRC Submission 044349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6216 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134296783-134332928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134329183 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 100 (E100G)
Ref Sequence ENSEMBL: ENSMUSP00000128314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168515] [ENSMUST00000186730] [ENSMUST00000189361]
Predicted Effect probably damaging
Transcript: ENSMUST00000168515
AA Change: E100G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458
AA Change: E100G

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186730
SMART Domains Protein: ENSMUSP00000139800
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 1 191 N/A INTRINSIC
coiled coil region 284 328 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
SAM 543 612 7e-12 SMART
SAM 649 716 1e-8 SMART
SAM 737 809 2.8e-9 SMART
low complexity region 862 875 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189361
AA Change: E100G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458
AA Change: E100G

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,627 D488G probably benign Het
Adgrv1 C A 13: 81,524,471 probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh3 G A 2: 94,008,536 probably benign Het
Ankrd22 A T 19: 34,124,169 probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arid2 A G 15: 96,356,909 D212G probably benign Het
Bbx A T 16: 50,251,388 S225T probably benign Het
Bivm T A 1: 44,126,868 probably null Het
Bpifb3 A G 2: 153,925,853 Y282C probably benign Het
Cacna1h A T 17: 25,378,819 I1767N probably damaging Het
Ccdc28a G T 10: 18,224,971 S36* probably null Het
Ccser2 A G 14: 36,940,508 S240P probably damaging Het
Ceacam1 A T 7: 25,471,996 S348T probably benign Het
Ddx49 C T 8: 70,297,284 G161D probably damaging Het
Dhx16 A G 17: 35,882,972 E353G possibly damaging Het
Etv2 A G 7: 30,634,611 probably null Het
Extl1 T C 4: 134,363,130 T345A probably benign Het
Fam163a A T 1: 156,078,995 S137T probably benign Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fsd1l T C 4: 53,694,742 C388R probably damaging Het
Galnt18 A C 7: 111,513,550 V470G probably benign Het
Grin2b T A 6: 135,772,399 I602F probably damaging Het
Gucy1b1 G T 3: 82,046,713 probably null Het
Hace1 T C 10: 45,618,547 V151A probably benign Het
Hadhb T A 5: 30,174,931 D258E probably benign Het
Heatr1 C T 13: 12,432,664 T1746I probably benign Het
Hrnr T C 3: 93,332,162 S3236P unknown Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kiz C A 2: 146,889,497 D302E probably damaging Het
Kng2 A T 16: 22,987,593 W619R probably damaging Het
Mfap3l C A 8: 60,671,807 T361K probably damaging Het
Mlec T C 5: 115,150,317 H160R probably benign Het
Myo16 T C 8: 10,315,494 L89P probably benign Het
Neb T C 2: 52,224,552 I4232V probably benign Het
Nf1 A G 11: 79,411,607 I334V possibly damaging Het
Nipbl A C 15: 8,318,383 F1942V probably damaging Het
Olfr1205 T C 2: 88,831,311 S65P probably damaging Het
Olfr1242 C A 2: 89,493,722 V197F probably damaging Het
Olfr642 A G 7: 104,049,695 Y220H probably damaging Het
Olfr699 A T 7: 106,790,458 I181N probably benign Het
Pabpc2 G T 18: 39,774,719 A346S probably damaging Het
Paxip1 T C 5: 27,766,173 T393A unknown Het
Pcdhgb5 A T 18: 37,731,928 T259S probably benign Het
Pfkp A T 13: 6,619,188 L253H probably benign Het
Piezo1 T C 8: 122,489,130 D1428G probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pkd1l2 T G 8: 117,081,470 D105A probably damaging Het
Pou2f1 G T 1: 165,880,320 probably benign Het
Ppp1r15a G T 7: 45,524,022 T454K probably damaging Het
Prpsap1 A T 11: 116,471,413 I381N probably damaging Het
Ptx3 T A 3: 66,224,844 V262E probably damaging Het
Rab21 A T 10: 115,294,926 H158Q probably benign Het
Rasa2 A G 9: 96,544,304 S830P probably damaging Het
Rdh1 G A 10: 127,764,753 S215N probably benign Het
Rhot1 G A 11: 80,251,059 R463H probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Selenom A T 11: 3,514,915 probably benign Het
Selenop T C 15: 3,279,465 C300R probably damaging Het
Skint1 T A 4: 112,021,482 S204T probably benign Het
Ss18l1 A G 2: 180,061,913 N313S unknown Het
Sycp2l A G 13: 41,141,724 D289G probably damaging Het
Terf1 C T 1: 15,818,997 H188Y probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Trdn A G 10: 33,305,069 T357A probably damaging Het
Trip11 A C 12: 101,890,600 M401R probably benign Het
Ubald2 A C 11: 116,434,385 D26A probably benign Het
Ube2w C G 1: 16,619,284 probably benign Het
Vmn2r101 T A 17: 19,591,005 S450R probably benign Het
Other mutations in Ppfia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Ppfia4 APN 1 134328086 missense probably benign 0.00
IGL01935:Ppfia4 APN 1 134317936 missense probably benign 0.02
IGL02008:Ppfia4 APN 1 134332391 missense probably damaging 1.00
R0037:Ppfia4 UTSW 1 134324089 missense probably damaging 1.00
R0084:Ppfia4 UTSW 1 134299426 missense possibly damaging 0.84
R0108:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0254:Ppfia4 UTSW 1 134324224 splice site probably benign
R0445:Ppfia4 UTSW 1 134327289 missense probably benign 0.31
R0504:Ppfia4 UTSW 1 134324113 missense probably damaging 1.00
R0617:Ppfia4 UTSW 1 134328780 missense probably damaging 1.00
R0839:Ppfia4 UTSW 1 134328807 missense probably null 1.00
R0849:Ppfia4 UTSW 1 134319372 missense probably benign 0.45
R0898:Ppfia4 UTSW 1 134321126 missense probably benign
R1173:Ppfia4 UTSW 1 134332283 splice site probably benign
R1728:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1729:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1730:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1762:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1783:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1784:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1785:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1812:Ppfia4 UTSW 1 134324573 missense probably benign 0.04
R2148:Ppfia4 UTSW 1 134312634 missense probably benign 0.25
R2160:Ppfia4 UTSW 1 134313723 missense probably benign 0.40
R2308:Ppfia4 UTSW 1 134332397 missense possibly damaging 0.94
R2421:Ppfia4 UTSW 1 134327400 missense probably benign 0.00
R3694:Ppfia4 UTSW 1 134312567 missense probably damaging 1.00
R3707:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3708:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3725:Ppfia4 UTSW 1 134313711 missense probably benign 0.04
R3964:Ppfia4 UTSW 1 134323016 missense probably benign
R4889:Ppfia4 UTSW 1 134300514 missense probably damaging 1.00
R4909:Ppfia4 UTSW 1 134332501 missense probably damaging 0.97
R4939:Ppfia4 UTSW 1 134328079 missense possibly damaging 0.67
R5226:Ppfia4 UTSW 1 134304286 critical splice donor site probably null
R5433:Ppfia4 UTSW 1 134317894 missense probably damaging 1.00
R5576:Ppfia4 UTSW 1 134323050 missense possibly damaging 0.81
R5727:Ppfia4 UTSW 1 134324077 critical splice donor site probably null
R5793:Ppfia4 UTSW 1 134312106 missense probably damaging 1.00
R6193:Ppfia4 UTSW 1 134324161 missense probably benign 0.04
R6679:Ppfia4 UTSW 1 134309679 missense probably damaging 1.00
R6742:Ppfia4 UTSW 1 134329171 missense probably damaging 1.00
R7039:Ppfia4 UTSW 1 134312115 missense probably damaging 0.97
R7206:Ppfia4 UTSW 1 134327389 missense probably benign 0.00
R7259:Ppfia4 UTSW 1 134313100 missense probably damaging 1.00
R7454:Ppfia4 UTSW 1 134324135 missense possibly damaging 0.87
R8139:Ppfia4 UTSW 1 134300528 missense probably benign 0.01
Z1176:Ppfia4 UTSW 1 134327379 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGCAAGAACCCAGTGCTG -3'
(R):5'- TAGTTCCCGATAGCTGTAGGC -3'

Sequencing Primer
(F):5'- CCAGTGCTGGGGACTAGGTG -3'
(R):5'- GCTGTAGGCTTCCTGCACTG -3'
Posted On2018-02-27