Incidental Mutation 'R6216:Hadhb'
ID503705
Institutional Source Beutler Lab
Gene Symbol Hadhb
Ensembl Gene ENSMUSG00000059447
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit
Synonyms4930479F15Rik, Mtpb
MMRRC Submission 044349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R6216 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30155248-30184593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30174931 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 258 (D258E)
Ref Sequence ENSEMBL: ENSMUSP00000110434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026841] [ENSMUST00000114783] [ENSMUST00000114786] [ENSMUST00000123980] [ENSMUST00000197109]
Predicted Effect probably benign
Transcript: ENSMUST00000026841
AA Change: D258E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026841
Gene: ENSMUSG00000059447
AA Change: D258E

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114783
AA Change: D258E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110431
Gene: ENSMUSG00000059447
AA Change: D258E

DomainStartEndE-ValueType
Pfam:Thiolase_N 55 325 1.4e-90 PFAM
Pfam:ketoacyl-synt 90 194 1.4e-10 PFAM
Pfam:Thiolase_C 332 472 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114786
AA Change: D258E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110434
Gene: ENSMUSG00000059447
AA Change: D258E

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122934
Predicted Effect unknown
Transcript: ENSMUST00000123980
AA Change: D166E
SMART Domains Protein: ENSMUSP00000118296
Gene: ENSMUSG00000059447
AA Change: D166E

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 129 3.7e-20 PFAM
Pfam:Thiolase_N 119 173 3.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157488
Predicted Effect probably benign
Transcript: ENSMUST00000197109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Mutations in this gene result in trifunctional protein deficiency. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for an ENU-induced mutation display reduced postnatal weight gain, multifocal cardiac fibrosis and hepatic steatosis, and develop cardiac arrhythmias that range from a prolonged PR interval to complete atrioventricular dissociation and lead to sudden between 9 and 16 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,627 D488G probably benign Het
Adgrv1 C A 13: 81,524,471 probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh3 G A 2: 94,008,536 probably benign Het
Ankrd22 A T 19: 34,124,169 probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arid2 A G 15: 96,356,909 D212G probably benign Het
Bbx A T 16: 50,251,388 S225T probably benign Het
Bivm T A 1: 44,126,868 probably null Het
Bpifb3 A G 2: 153,925,853 Y282C probably benign Het
Cacna1h A T 17: 25,378,819 I1767N probably damaging Het
Ccdc28a G T 10: 18,224,971 S36* probably null Het
Ccser2 A G 14: 36,940,508 S240P probably damaging Het
Ceacam1 A T 7: 25,471,996 S348T probably benign Het
Ddx49 C T 8: 70,297,284 G161D probably damaging Het
Dhx16 A G 17: 35,882,972 E353G possibly damaging Het
Etv2 A G 7: 30,634,611 probably null Het
Extl1 T C 4: 134,363,130 T345A probably benign Het
Fam163a A T 1: 156,078,995 S137T probably benign Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fsd1l T C 4: 53,694,742 C388R probably damaging Het
Galnt18 A C 7: 111,513,550 V470G probably benign Het
Grin2b T A 6: 135,772,399 I602F probably damaging Het
Gucy1b1 G T 3: 82,046,713 probably null Het
Hace1 T C 10: 45,618,547 V151A probably benign Het
Heatr1 C T 13: 12,432,664 T1746I probably benign Het
Hrnr T C 3: 93,332,162 S3236P unknown Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kiz C A 2: 146,889,497 D302E probably damaging Het
Kng2 A T 16: 22,987,593 W619R probably damaging Het
Mfap3l C A 8: 60,671,807 T361K probably damaging Het
Mlec T C 5: 115,150,317 H160R probably benign Het
Myo16 T C 8: 10,315,494 L89P probably benign Het
Neb T C 2: 52,224,552 I4232V probably benign Het
Nf1 A G 11: 79,411,607 I334V possibly damaging Het
Nipbl A C 15: 8,318,383 F1942V probably damaging Het
Olfr1205 T C 2: 88,831,311 S65P probably damaging Het
Olfr1242 C A 2: 89,493,722 V197F probably damaging Het
Olfr642 A G 7: 104,049,695 Y220H probably damaging Het
Olfr699 A T 7: 106,790,458 I181N probably benign Het
Pabpc2 G T 18: 39,774,719 A346S probably damaging Het
Paxip1 T C 5: 27,766,173 T393A unknown Het
Pcdhgb5 A T 18: 37,731,928 T259S probably benign Het
Pfkp A T 13: 6,619,188 L253H probably benign Het
Piezo1 T C 8: 122,489,130 D1428G probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pkd1l2 T G 8: 117,081,470 D105A probably damaging Het
Pou2f1 G T 1: 165,880,320 probably benign Het
Ppfia4 T C 1: 134,329,183 E100G probably damaging Het
Ppp1r15a G T 7: 45,524,022 T454K probably damaging Het
Prpsap1 A T 11: 116,471,413 I381N probably damaging Het
Ptx3 T A 3: 66,224,844 V262E probably damaging Het
Rab21 A T 10: 115,294,926 H158Q probably benign Het
Rasa2 A G 9: 96,544,304 S830P probably damaging Het
Rdh1 G A 10: 127,764,753 S215N probably benign Het
Rhot1 G A 11: 80,251,059 R463H probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Selenom A T 11: 3,514,915 probably benign Het
Selenop T C 15: 3,279,465 C300R probably damaging Het
Skint1 T A 4: 112,021,482 S204T probably benign Het
Ss18l1 A G 2: 180,061,913 N313S unknown Het
Sycp2l A G 13: 41,141,724 D289G probably damaging Het
Terf1 C T 1: 15,818,997 H188Y probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Trdn A G 10: 33,305,069 T357A probably damaging Het
Trip11 A C 12: 101,890,600 M401R probably benign Het
Ubald2 A C 11: 116,434,385 D26A probably benign Het
Ube2w C G 1: 16,619,284 probably benign Het
Vmn2r101 T A 17: 19,591,005 S450R probably benign Het
Other mutations in Hadhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Hadhb APN 5 30166749 missense probably null 0.99
IGL02472:Hadhb APN 5 30184063 missense possibly damaging 0.68
R0110:Hadhb UTSW 5 30169485 splice site probably benign
R0481:Hadhb UTSW 5 30168545 missense probably damaging 1.00
R0578:Hadhb UTSW 5 30178806 missense probably benign
R1483:Hadhb UTSW 5 30169494 critical splice acceptor site probably null
R1552:Hadhb UTSW 5 30176933 missense probably null 0.66
R1616:Hadhb UTSW 5 30166715 missense probably damaging 1.00
R1926:Hadhb UTSW 5 30180937 missense possibly damaging 0.94
R2064:Hadhb UTSW 5 30173798 splice site probably null
R5066:Hadhb UTSW 5 30164096 intron probably benign
R5298:Hadhb UTSW 5 30177011 critical splice donor site probably null
R6787:Hadhb UTSW 5 30155249 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACACCTCTTAAGAGCAGAGCT -3'
(R):5'- ACGTGAGTCCATGTTTAAGAATAAA -3'

Sequencing Primer
(F):5'- CAGAGCTGTTCTGTGTCTCC -3'
(R):5'- GGATACAGATTTGGTTCCCAGCAC -3'
Posted On2018-02-27