Incidental Mutation 'R6216:Grin2b'
ID503710
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 044349-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6216 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135772399 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 602 (I602F)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: I602F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I602F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: I602F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I602F

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,627 D488G probably benign Het
Adgrv1 C A 13: 81,524,471 probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh3 G A 2: 94,008,536 probably benign Het
Ankrd22 A T 19: 34,124,169 probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arid2 A G 15: 96,356,909 D212G probably benign Het
Bbx A T 16: 50,251,388 S225T probably benign Het
Bivm T A 1: 44,126,868 probably null Het
Bpifb3 A G 2: 153,925,853 Y282C probably benign Het
Cacna1h A T 17: 25,378,819 I1767N probably damaging Het
Ccdc28a G T 10: 18,224,971 S36* probably null Het
Ccser2 A G 14: 36,940,508 S240P probably damaging Het
Ceacam1 A T 7: 25,471,996 S348T probably benign Het
Ddx49 C T 8: 70,297,284 G161D probably damaging Het
Dhx16 A G 17: 35,882,972 E353G possibly damaging Het
Etv2 A G 7: 30,634,611 probably null Het
Extl1 T C 4: 134,363,130 T345A probably benign Het
Fam163a A T 1: 156,078,995 S137T probably benign Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fsd1l T C 4: 53,694,742 C388R probably damaging Het
Galnt18 A C 7: 111,513,550 V470G probably benign Het
Gucy1b1 G T 3: 82,046,713 probably null Het
Hace1 T C 10: 45,618,547 V151A probably benign Het
Hadhb T A 5: 30,174,931 D258E probably benign Het
Heatr1 C T 13: 12,432,664 T1746I probably benign Het
Hrnr T C 3: 93,332,162 S3236P unknown Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kiz C A 2: 146,889,497 D302E probably damaging Het
Kng2 A T 16: 22,987,593 W619R probably damaging Het
Mfap3l C A 8: 60,671,807 T361K probably damaging Het
Mlec T C 5: 115,150,317 H160R probably benign Het
Myo16 T C 8: 10,315,494 L89P probably benign Het
Neb T C 2: 52,224,552 I4232V probably benign Het
Nf1 A G 11: 79,411,607 I334V possibly damaging Het
Nipbl A C 15: 8,318,383 F1942V probably damaging Het
Olfr1205 T C 2: 88,831,311 S65P probably damaging Het
Olfr1242 C A 2: 89,493,722 V197F probably damaging Het
Olfr642 A G 7: 104,049,695 Y220H probably damaging Het
Olfr699 A T 7: 106,790,458 I181N probably benign Het
Pabpc2 G T 18: 39,774,719 A346S probably damaging Het
Paxip1 T C 5: 27,766,173 T393A unknown Het
Pcdhgb5 A T 18: 37,731,928 T259S probably benign Het
Pfkp A T 13: 6,619,188 L253H probably benign Het
Piezo1 T C 8: 122,489,130 D1428G probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pkd1l2 T G 8: 117,081,470 D105A probably damaging Het
Pou2f1 G T 1: 165,880,320 probably benign Het
Ppfia4 T C 1: 134,329,183 E100G probably damaging Het
Ppp1r15a G T 7: 45,524,022 T454K probably damaging Het
Prpsap1 A T 11: 116,471,413 I381N probably damaging Het
Ptx3 T A 3: 66,224,844 V262E probably damaging Het
Rab21 A T 10: 115,294,926 H158Q probably benign Het
Rasa2 A G 9: 96,544,304 S830P probably damaging Het
Rdh1 G A 10: 127,764,753 S215N probably benign Het
Rhot1 G A 11: 80,251,059 R463H probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Selenom A T 11: 3,514,915 probably benign Het
Selenop T C 15: 3,279,465 C300R probably damaging Het
Skint1 T A 4: 112,021,482 S204T probably benign Het
Ss18l1 A G 2: 180,061,913 N313S unknown Het
Sycp2l A G 13: 41,141,724 D289G probably damaging Het
Terf1 C T 1: 15,818,997 H188Y probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Trdn A G 10: 33,305,069 T357A probably damaging Het
Trip11 A C 12: 101,890,600 M401R probably benign Het
Ubald2 A C 11: 116,434,385 D26A probably benign Het
Ube2w C G 1: 16,619,284 probably benign Het
Vmn2r101 T A 17: 19,591,005 S450R probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTTGGATCATGAAGGCGG -3'
(R):5'- TCTGGAGTTACCTCTAAGAAACCC -3'

Sequencing Primer
(F):5'- TCTTGGATCATGAAGGCGGCTAAG -3'
(R):5'- AGACACAGGATCTTGACTTGTG -3'
Posted On2018-02-27