Incidental Mutation 'R6216:Pkd1l2'
ID503721
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Namepolycystic kidney disease 1 like 2
Synonyms
MMRRC Submission 044349-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6216 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location116995679-117082449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 117081470 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 105 (D105A)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
Predicted Effect probably damaging
Transcript: ENSMUST00000098375
AA Change: D105A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: D105A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109093
AA Change: D105A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: D105A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,627 D488G probably benign Het
Adgrv1 C A 13: 81,524,471 probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alkbh3 G A 2: 94,008,536 probably benign Het
Ankrd22 A T 19: 34,124,169 probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arid2 A G 15: 96,356,909 D212G probably benign Het
Bbx A T 16: 50,251,388 S225T probably benign Het
Bivm T A 1: 44,126,868 probably null Het
Bpifb3 A G 2: 153,925,853 Y282C probably benign Het
Cacna1h A T 17: 25,378,819 I1767N probably damaging Het
Ccdc28a G T 10: 18,224,971 S36* probably null Het
Ccser2 A G 14: 36,940,508 S240P probably damaging Het
Ceacam1 A T 7: 25,471,996 S348T probably benign Het
Ddx49 C T 8: 70,297,284 G161D probably damaging Het
Dhx16 A G 17: 35,882,972 E353G possibly damaging Het
Etv2 A G 7: 30,634,611 probably null Het
Extl1 T C 4: 134,363,130 T345A probably benign Het
Fam163a A T 1: 156,078,995 S137T probably benign Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fsd1l T C 4: 53,694,742 C388R probably damaging Het
Galnt18 A C 7: 111,513,550 V470G probably benign Het
Grin2b T A 6: 135,772,399 I602F probably damaging Het
Gucy1b1 G T 3: 82,046,713 probably null Het
Hace1 T C 10: 45,618,547 V151A probably benign Het
Hadhb T A 5: 30,174,931 D258E probably benign Het
Heatr1 C T 13: 12,432,664 T1746I probably benign Het
Hrnr T C 3: 93,332,162 S3236P unknown Het
Kcnd1 G C X: 7,823,909 A23P probably damaging Homo
Kiz C A 2: 146,889,497 D302E probably damaging Het
Kng2 A T 16: 22,987,593 W619R probably damaging Het
Mfap3l C A 8: 60,671,807 T361K probably damaging Het
Mlec T C 5: 115,150,317 H160R probably benign Het
Myo16 T C 8: 10,315,494 L89P probably benign Het
Neb T C 2: 52,224,552 I4232V probably benign Het
Nf1 A G 11: 79,411,607 I334V possibly damaging Het
Nipbl A C 15: 8,318,383 F1942V probably damaging Het
Olfr1205 T C 2: 88,831,311 S65P probably damaging Het
Olfr1242 C A 2: 89,493,722 V197F probably damaging Het
Olfr642 A G 7: 104,049,695 Y220H probably damaging Het
Olfr699 A T 7: 106,790,458 I181N probably benign Het
Pabpc2 G T 18: 39,774,719 A346S probably damaging Het
Paxip1 T C 5: 27,766,173 T393A unknown Het
Pcdhgb5 A T 18: 37,731,928 T259S probably benign Het
Pfkp A T 13: 6,619,188 L253H probably benign Het
Piezo1 T C 8: 122,489,130 D1428G probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pou2f1 G T 1: 165,880,320 probably benign Het
Ppfia4 T C 1: 134,329,183 E100G probably damaging Het
Ppp1r15a G T 7: 45,524,022 T454K probably damaging Het
Prpsap1 A T 11: 116,471,413 I381N probably damaging Het
Ptx3 T A 3: 66,224,844 V262E probably damaging Het
Rab21 A T 10: 115,294,926 H158Q probably benign Het
Rasa2 A G 9: 96,544,304 S830P probably damaging Het
Rdh1 G A 10: 127,764,753 S215N probably benign Het
Rhot1 G A 11: 80,251,059 R463H probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Selenom A T 11: 3,514,915 probably benign Het
Selenop T C 15: 3,279,465 C300R probably damaging Het
Skint1 T A 4: 112,021,482 S204T probably benign Het
Ss18l1 A G 2: 180,061,913 N313S unknown Het
Sycp2l A G 13: 41,141,724 D289G probably damaging Het
Terf1 C T 1: 15,818,997 H188Y probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Trdn A G 10: 33,305,069 T357A probably damaging Het
Trip11 A C 12: 101,890,600 M401R probably benign Het
Ubald2 A C 11: 116,434,385 D26A probably benign Het
Ube2w C G 1: 16,619,284 probably benign Het
Vmn2r101 T A 17: 19,591,005 S450R probably benign Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117028479 missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117030682 missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117068110 missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117060594 missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117065529 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGTCTGCAGGCAAGGCAC -3'
(R):5'- TGAGGACACACCCATTCTCTG -3'

Sequencing Primer
(F):5'- AGGCAAGGCACCTGGAC -3'
(R):5'- ACACCCATTCTCTGGTGTGGG -3'
Posted On2018-02-27