Mutagenetix > Incidental Mutation

Incidental Mutation 'R6216:Nipbl'

503744

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4933421G18Rik, 4921518A06Rik

MMRRC Submission

044349-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R6216 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8320101-8473947 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 8347867 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 1942 (F1942V)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000052965
AA Change: F1942V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: F1942V

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	T	C	9: 57,164,910 (GRCm39)	D488G	probably benign	Het
Adgrv1	C	A	13: 81,672,590 (GRCm39)		probably null	Het
Afg3l2	G	T	18: 67,554,329 (GRCm39)	L458M	probably damaging	Het
Alkbh3	G	A	2: 93,838,881 (GRCm39)		probably benign	Het
Ankrd22	A	T	19: 34,101,569 (GRCm39)		probably null	Het
Anks1b	A	G	10: 90,096,618 (GRCm39)	D425G	probably damaging	Het
Arid2	A	G	15: 96,254,790 (GRCm39)	D212G	probably benign	Het
Bbx	A	T	16: 50,071,751 (GRCm39)	S225T	probably benign	Het
Bivm	T	A	1: 44,166,028 (GRCm39)		probably null	Het
Bpifb3	A	G	2: 153,767,773 (GRCm39)	Y282C	probably benign	Het
Cacna1h	A	T	17: 25,597,793 (GRCm39)	I1767N	probably damaging	Het
Ccdc28a	G	T	10: 18,100,719 (GRCm39)	S36*	probably null	Het
Ccser2	A	G	14: 36,662,465 (GRCm39)	S240P	probably damaging	Het
Ceacam1	A	T	7: 25,171,421 (GRCm39)	S348T	probably benign	Het
Ddx49	C	T	8: 70,749,934 (GRCm39)	G161D	probably damaging	Het
Dhx16	A	G	17: 36,193,864 (GRCm39)	E353G	possibly damaging	Het
Dnaaf6rt	A	T	1: 31,262,432 (GRCm39)	D138V	probably damaging	Het
Etv2	A	G	7: 30,334,036 (GRCm39)		probably null	Het
Extl1	T	C	4: 134,090,441 (GRCm39)	T345A	probably benign	Het
Fam163a	A	T	1: 155,954,741 (GRCm39)	S137T	probably benign	Het
Fermt2	A	T	14: 45,697,338 (GRCm39)	M671K	possibly damaging	Het
Fsd1l	T	C	4: 53,694,742 (GRCm39)	C388R	probably damaging	Het
Galnt18	A	C	7: 111,112,757 (GRCm39)	V470G	probably benign	Het
Grin2b	T	A	6: 135,749,397 (GRCm39)	I602F	probably damaging	Het
Gucy1b1	G	T	3: 81,954,020 (GRCm39)		probably null	Het
Hace1	T	C	10: 45,494,643 (GRCm39)	V151A	probably benign	Het
Hadhb	T	A	5: 30,379,929 (GRCm39)	D258E	probably benign	Het
Heatr1	C	T	13: 12,447,545 (GRCm39)	T1746I	probably benign	Het
Hrnr	T	C	3: 93,239,469 (GRCm39)	S3236P	unknown	Het
Kcnd1	G	C	X: 7,690,148 (GRCm39)	A23P	probably damaging	Homo
Kiz	C	A	2: 146,731,417 (GRCm39)	D302E	probably damaging	Het
Kng2	A	T	16: 22,806,343 (GRCm39)	W619R	probably damaging	Het
Mfap3l	C	A	8: 61,124,841 (GRCm39)	T361K	probably damaging	Het
Mlec	T	C	5: 115,288,376 (GRCm39)	H160R	probably benign	Het
Myo16	T	C	8: 10,365,494 (GRCm39)	L89P	probably benign	Het
Neb	T	C	2: 52,114,564 (GRCm39)	I4232V	probably benign	Het
Nf1	A	G	11: 79,302,433 (GRCm39)	I334V	possibly damaging	Het
Or2ag17	A	T	7: 106,389,665 (GRCm39)	I181N	probably benign	Het
Or4a70	C	A	2: 89,324,066 (GRCm39)	V197F	probably damaging	Het
Or4c11c	T	C	2: 88,661,655 (GRCm39)	S65P	probably damaging	Het
Or51a10	A	G	7: 103,698,902 (GRCm39)	Y220H	probably damaging	Het
Pabpc2	G	T	18: 39,907,772 (GRCm39)	A346S	probably damaging	Het
Paxip1	T	C	5: 27,971,171 (GRCm39)	T393A	unknown	Het
Pcdhgb5	A	T	18: 37,864,981 (GRCm39)	T259S	probably benign	Het
Pfkp	A	T	13: 6,669,224 (GRCm39)	L253H	probably benign	Het
Piezo1	T	C	8: 123,215,869 (GRCm39)	D1428G	probably benign	Het
Pkd1l2	T	G	8: 117,808,209 (GRCm39)	D105A	probably damaging	Het
Pou2f1	G	T	1: 165,707,889 (GRCm39)		probably benign	Het
Ppfia4	T	C	1: 134,256,921 (GRCm39)	E100G	probably damaging	Het
Ppp1r15a	G	T	7: 45,173,446 (GRCm39)	T454K	probably damaging	Het
Prpsap1	A	T	11: 116,362,239 (GRCm39)	I381N	probably damaging	Het
Ptx3	T	A	3: 66,132,265 (GRCm39)	V262E	probably damaging	Het
Rab21	A	T	10: 115,130,831 (GRCm39)	H158Q	probably benign	Het
Rasa2	A	G	9: 96,426,357 (GRCm39)	S830P	probably damaging	Het
Rdh1	G	A	10: 127,600,622 (GRCm39)	S215N	probably benign	Het
Rhot1	G	A	11: 80,141,885 (GRCm39)	R463H	probably benign	Het
Rsf1	CG	CGACGGCGGGG	7: 97,229,115 (GRCm39)		probably benign	Het
Sart3	C	T	5: 113,881,267 (GRCm39)	A938T	probably benign	Het
Selenom	A	T	11: 3,464,915 (GRCm39)		probably benign	Het
Selenop	T	C	15: 3,308,947 (GRCm39)	C300R	probably damaging	Het
Skint1	T	A	4: 111,878,679 (GRCm39)	S204T	probably benign	Het
Ss18l1	A	G	2: 179,703,706 (GRCm39)	N313S	unknown	Het
Sycp2l	A	G	13: 41,295,200 (GRCm39)	D289G	probably damaging	Het
Terf1	C	T	1: 15,889,221 (GRCm39)	H188Y	probably benign	Het
Tmem116	C	T	5: 121,629,171 (GRCm39)	T188M	probably benign	Het
Trdn	A	G	10: 33,181,065 (GRCm39)	T357A	probably damaging	Het
Trip11	A	C	12: 101,856,859 (GRCm39)	M401R	probably benign	Het
Ubald2	A	C	11: 116,325,211 (GRCm39)	D26A	probably benign	Het
Ube2w	C	G	1: 16,689,508 (GRCm39)		probably benign	Het
Vmn2r101	T	A	17: 19,811,267 (GRCm39)	S450R	probably benign	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,396,157 (GRCm39)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,398,958 (GRCm39)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,326,353 (GRCm39)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,379,939 (GRCm39)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,379,981 (GRCm39)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,340,693 (GRCm39)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,380,023 (GRCm39)	missense	probably benign
IGL01723:Nipbl	APN	15	8,364,555 (GRCm39)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,391,305 (GRCm39)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,356,574 (GRCm39)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,388,558 (GRCm39)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,373,058 (GRCm39)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,353,131 (GRCm39)	splice site	probably null
IGL02547:Nipbl	APN	15	8,381,082 (GRCm39)	missense	probably benign
IGL02678:Nipbl	APN	15	8,380,594 (GRCm39)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,325,037 (GRCm39)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,379,798 (GRCm39)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,361,936 (GRCm39)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,368,463 (GRCm39)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,322,569 (GRCm39)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,380,360 (GRCm39)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8,391,221 (GRCm39)	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R0422:Nipbl	UTSW	15	8,381,112 (GRCm39)	missense	probably benign
R0486:Nipbl	UTSW	15	8,368,354 (GRCm39)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,332,964 (GRCm39)	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8,390,488 (GRCm39)	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8,322,562 (GRCm39)	splice site	probably null
R0726:Nipbl	UTSW	15	8,381,039 (GRCm39)	missense	probably benign
R0881:Nipbl	UTSW	15	8,337,096 (GRCm39)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,391,202 (GRCm39)	missense	probably benign
R0969:Nipbl	UTSW	15	8,321,712 (GRCm39)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,401,657 (GRCm39)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,379,773 (GRCm39)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,380,764 (GRCm39)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,396,148 (GRCm39)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,332,396 (GRCm39)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,368,035 (GRCm39)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,348,972 (GRCm39)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,373,001 (GRCm39)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,356,616 (GRCm39)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,379,771 (GRCm39)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,353,951 (GRCm39)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,340,691 (GRCm39)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,366,403 (GRCm39)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,322,702 (GRCm39)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,380,966 (GRCm39)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,364,490 (GRCm39)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,353,182 (GRCm39)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,340,723 (GRCm39)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,373,076 (GRCm39)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,325,145 (GRCm39)	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8,388,358 (GRCm39)	missense	probably benign
R3902:Nipbl	UTSW	15	8,379,730 (GRCm39)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,380,018 (GRCm39)	missense	probably benign
R4164:Nipbl	UTSW	15	8,368,418 (GRCm39)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,361,916 (GRCm39)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,388,690 (GRCm39)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,391,345 (GRCm39)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,368,208 (GRCm39)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,332,468 (GRCm39)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,395,313 (GRCm39)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,380,981 (GRCm39)	missense	probably benign
R5428:Nipbl	UTSW	15	8,359,780 (GRCm39)	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8,396,196 (GRCm39)	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5644:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5681:Nipbl	UTSW	15	8,330,866 (GRCm39)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,354,133 (GRCm39)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,364,328 (GRCm39)	splice site	probably null
R5970:Nipbl	UTSW	15	8,326,302 (GRCm39)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,353,748 (GRCm39)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,325,052 (GRCm39)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,364,390 (GRCm39)	missense	probably damaging	1.00
R6236:Nipbl	UTSW	15	8,354,064 (GRCm39)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,381,049 (GRCm39)	missense	probably benign
R6707:Nipbl	UTSW	15	8,354,043 (GRCm39)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,352,074 (GRCm39)	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8,332,969 (GRCm39)	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8,321,619 (GRCm39)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,373,090 (GRCm39)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,359,779 (GRCm39)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,325,120 (GRCm39)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,372,977 (GRCm39)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,335,356 (GRCm39)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,322,585 (GRCm39)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,381,010 (GRCm39)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,388,186 (GRCm39)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,326,333 (GRCm39)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,320,971 (GRCm39)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,355,236 (GRCm39)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,340,742 (GRCm39)	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8,340,734 (GRCm39)	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8,388,696 (GRCm39)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,368,225 (GRCm39)	missense	probably benign
R8739:Nipbl	UTSW	15	8,332,904 (GRCm39)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,330,210 (GRCm39)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,391,271 (GRCm39)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,381,104 (GRCm39)	missense	probably benign
R8991:Nipbl	UTSW	15	8,320,997 (GRCm39)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,356,608 (GRCm39)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,368,215 (GRCm39)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,380,340 (GRCm39)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,366,373 (GRCm39)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,321,032 (GRCm39)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,388,418 (GRCm39)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,381,199 (GRCm39)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,353,021 (GRCm39)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,337,366 (GRCm39)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,368,183 (GRCm39)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,368,164 (GRCm39)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,366,436 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAGTCAACTGGATAACTGATTC -3'
(R):5'- GTATGCATATACTTCATGCTACAGC -3'

Sequencing Primer
(F):5'- ACTGGATAACTGATTCAATAACCAAC -3'
(R):5'- GCTCTCTCTGAGGTTCATGGTC -3'

Posted On

2018-02-27