Incidental Mutation 'R6217:Rex2'
ID503771
Institutional Source Beutler Lab
Gene Symbol Rex2
Ensembl Gene ENSMUSG00000067919
Gene Namereduced expression 2
SynonymsGm13138
MMRRC Submission 044350-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6217 (G1)
Quality Score121.008
Status Not validated
Chromosome4
Chromosomal Location147021850-147060794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147057474 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 140 (T140A)
Ref Sequence ENSEMBL: ENSMUSP00000075179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075775
AA Change: T140A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075179
Gene: ENSMUSG00000067919
AA Change: T140A

DomainStartEndE-ValueType
KRAB 28 90 1.46e-16 SMART
low complexity region 235 246 N/A INTRINSIC
ZnF_C2H2 251 273 7.9e-4 SMART
ZnF_C2H2 279 301 7.9e-4 SMART
ZnF_C2H2 307 329 3.49e-5 SMART
ZnF_C2H2 335 357 1.95e-3 SMART
ZnF_C2H2 363 385 7.9e-4 SMART
ZnF_C2H2 391 413 7.9e-4 SMART
ZnF_C2H2 419 441 3.49e-5 SMART
ZnF_C2H2 447 469 3.89e-3 SMART
ZnF_C2H2 475 497 2.75e-3 SMART
ZnF_C2H2 503 525 3.04e-5 SMART
ZnF_C2H2 531 553 8.34e-3 SMART
ZnF_C2H2 559 581 1.58e-3 SMART
ZnF_C2H2 587 609 1.22e-4 SMART
ZnF_C2H2 615 637 1.28e-3 SMART
ZnF_C2H2 643 665 3.11e-2 SMART
low complexity region 669 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181752
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,926,085 P118S possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adamts20 T C 15: 94,338,715 D808G probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arsk T A 13: 76,091,816 Q46L unknown Het
Asnsd1 A G 1: 53,348,028 F147L probably benign Het
Atp5a1 T A 18: 77,781,356 S427T probably benign Het
Atp6v1b2 A C 8: 69,109,878 probably null Het
AU021092 T A 16: 5,212,186 T322S possibly damaging Het
Bcl7c A T 7: 127,708,526 M1K probably null Het
Cacna1i T C 15: 80,389,132 V1673A probably damaging Het
Ccdc146 A T 5: 21,317,902 probably null Het
Cdc7 A G 5: 106,972,794 D122G probably damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Chd3 T A 11: 69,345,535 Q1950L probably damaging Het
Cutc T C 19: 43,759,997 L111S probably damaging Het
Cyp2j6 A G 4: 96,518,161 F458L probably damaging Het
Ddhd1 T C 14: 45,619,514 probably null Het
Dstyk T C 1: 132,459,939 S804P probably damaging Het
Ech1 A G 7: 28,831,836 D283G possibly damaging Het
Exosc10 A G 4: 148,582,311 probably null Het
Fam160b2 T C 14: 70,591,758 probably null Het
Fancg A C 4: 43,010,084 V5G probably benign Het
Fbxo11 A G 17: 88,008,904 V394A probably benign Het
Fcmr C T 1: 130,878,323 R339W probably damaging Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Gab1 A G 8: 80,791,608 V125A possibly damaging Het
Gabrr1 A T 4: 33,149,026 probably null Het
Gon4l T C 3: 88,892,661 V871A possibly damaging Het
Hspg2 A G 4: 137,540,248 T2056A probably damaging Het
Lrrc3 T A 10: 77,901,009 T198S probably benign Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Ltbr C T 6: 125,307,454 V342M probably damaging Het
Muc16 A T 9: 18,655,446 S1926T unknown Het
Ntn1 C A 11: 68,213,332 V497F possibly damaging Het
Olfr181 T C 16: 58,926,514 D19G probably benign Het
Olfr700 A T 7: 106,806,072 L130Q probably damaging Het
Olfr936 A T 9: 39,046,743 *270R probably null Het
Osmr T C 15: 6,823,566 Y615C probably damaging Het
Pcdhgb2 T C 18: 37,690,001 V15A possibly damaging Het
Pkd2l2 A G 18: 34,414,680 N162S probably benign Het
Ppp1r12a G A 10: 108,240,184 probably null Het
Prtg C T 9: 72,904,794 P899S probably damaging Het
Ptprn A T 1: 75,248,166 S912R probably damaging Het
Ryr2 T G 13: 11,834,078 D339A probably damaging Het
Sf3b1 C T 1: 55,007,518 R289H probably damaging Het
Slc17a9 A G 2: 180,737,662 D309G probably benign Het
Slc4a10 A G 2: 62,303,951 R1004G probably benign Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Syne1 C T 10: 5,293,761 G2801D probably benign Het
Tenm3 A T 8: 48,293,665 V1026D probably damaging Het
Ticam1 A T 17: 56,270,730 I455N probably damaging Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Ubn1 A G 16: 5,077,232 E714G probably damaging Het
Ush2a T G 1: 188,743,454 probably null Het
Usp19 G A 9: 108,500,144 V874M probably damaging Het
Vmn2r106 T C 17: 20,268,239 T633A probably benign Het
Vmn2r75 A T 7: 86,166,167 probably benign Het
Zfyve27 T C 19: 42,189,577 V386A probably damaging Het
Zscan20 A T 4: 128,604,534 W24R probably damaging Het
Other mutations in Rex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4080:Rex2 UTSW 4 147058697 missense probably benign
R5075:Rex2 UTSW 4 147057694 missense possibly damaging 0.72
R5294:Rex2 UTSW 4 147057985 missense probably benign 0.07
R6298:Rex2 UTSW 4 147057515 nonsense probably null
R6302:Rex2 UTSW 4 147057994 missense possibly damaging 0.95
R6614:Rex2 UTSW 4 147052561 missense probably benign 0.08
R7572:Rex2 UTSW 4 147057872 missense probably damaging 0.98
R7827:Rex2 UTSW 4 147058090 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACTGCATATGTGGAAACTATGAG -3'
(R):5'- GTCACTCTGAGTAAAGCATTTGTC -3'

Sequencing Primer
(F):5'- CTATGAGAAGGAGAAGGTCTTGGAAC -3'
(R):5'- GCATTTGTCAAATTCACCACAAG -3'
Posted On2018-02-27