Incidental Mutation 'R6217:Ltbr'
ID503776
Institutional Source Beutler Lab
Gene Symbol Ltbr
Ensembl Gene ENSMUSG00000030339
Gene Namelymphotoxin B receptor
SynonymsTNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar
MMRRC Submission 044350-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6217 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125306571-125313885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125307454 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 342 (V342M)
Ref Sequence ENSEMBL: ENSMUSP00000032489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032489]
Predicted Effect probably damaging
Transcript: ENSMUST00000032489
AA Change: V342M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339
AA Change: V342M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
TNFR 43 80 5.73e-5 SMART
TNFR 83 124 3.96e-8 SMART
Blast:TNFR 126 169 3e-7 BLAST
TNFR 172 212 1.95e-7 SMART
transmembrane domain 222 244 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 362 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161891
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,926,085 P118S possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adamts20 T C 15: 94,338,715 D808G probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arsk T A 13: 76,091,816 Q46L unknown Het
Asnsd1 A G 1: 53,348,028 F147L probably benign Het
Atp5a1 T A 18: 77,781,356 S427T probably benign Het
Atp6v1b2 A C 8: 69,109,878 probably null Het
AU021092 T A 16: 5,212,186 T322S possibly damaging Het
Bcl7c A T 7: 127,708,526 M1K probably null Het
Cacna1i T C 15: 80,389,132 V1673A probably damaging Het
Ccdc146 A T 5: 21,317,902 probably null Het
Cdc7 A G 5: 106,972,794 D122G probably damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Chd3 T A 11: 69,345,535 Q1950L probably damaging Het
Cutc T C 19: 43,759,997 L111S probably damaging Het
Cyp2j6 A G 4: 96,518,161 F458L probably damaging Het
Ddhd1 T C 14: 45,619,514 probably null Het
Dstyk T C 1: 132,459,939 S804P probably damaging Het
Ech1 A G 7: 28,831,836 D283G possibly damaging Het
Exosc10 A G 4: 148,582,311 probably null Het
Fam160b2 T C 14: 70,591,758 probably null Het
Fancg A C 4: 43,010,084 V5G probably benign Het
Fbxo11 A G 17: 88,008,904 V394A probably benign Het
Fcmr C T 1: 130,878,323 R339W probably damaging Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Gab1 A G 8: 80,791,608 V125A possibly damaging Het
Gabrr1 A T 4: 33,149,026 probably null Het
Gon4l T C 3: 88,892,661 V871A possibly damaging Het
Hspg2 A G 4: 137,540,248 T2056A probably damaging Het
Lrrc3 T A 10: 77,901,009 T198S probably benign Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Muc16 A T 9: 18,655,446 S1926T unknown Het
Ntn1 C A 11: 68,213,332 V497F possibly damaging Het
Olfr181 T C 16: 58,926,514 D19G probably benign Het
Olfr700 A T 7: 106,806,072 L130Q probably damaging Het
Olfr936 A T 9: 39,046,743 *270R probably null Het
Osmr T C 15: 6,823,566 Y615C probably damaging Het
Pcdhgb2 T C 18: 37,690,001 V15A possibly damaging Het
Pkd2l2 A G 18: 34,414,680 N162S probably benign Het
Ppp1r12a G A 10: 108,240,184 probably null Het
Prtg C T 9: 72,904,794 P899S probably damaging Het
Ptprn A T 1: 75,248,166 S912R probably damaging Het
Rex2 A G 4: 147,057,474 T140A possibly damaging Het
Ryr2 T G 13: 11,834,078 D339A probably damaging Het
Sf3b1 C T 1: 55,007,518 R289H probably damaging Het
Slc17a9 A G 2: 180,737,662 D309G probably benign Het
Slc4a10 A G 2: 62,303,951 R1004G probably benign Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Syne1 C T 10: 5,293,761 G2801D probably benign Het
Tenm3 A T 8: 48,293,665 V1026D probably damaging Het
Ticam1 A T 17: 56,270,730 I455N probably damaging Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Ubn1 A G 16: 5,077,232 E714G probably damaging Het
Ush2a T G 1: 188,743,454 probably null Het
Usp19 G A 9: 108,500,144 V874M probably damaging Het
Vmn2r106 T C 17: 20,268,239 T633A probably benign Het
Vmn2r75 A T 7: 86,166,167 probably benign Het
Zfyve27 T C 19: 42,189,577 V386A probably damaging Het
Zscan20 A T 4: 128,604,534 W24R probably damaging Het
Other mutations in Ltbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Ltbr APN 6 125312366 missense probably damaging 0.96
armitage UTSW 6 125312794 missense probably damaging 0.97
bonsai UTSW 6 125312770 missense probably damaging 1.00
kama UTSW 6 125313388 critical splice donor site probably null
marine_blue UTSW 6 125312808 missense probably damaging 0.98
moksha UTSW 6 125308068 missense probably benign 0.00
Questionable UTSW 6 125313375 splice site probably benign
R0090:Ltbr UTSW 6 125309449 splice site probably benign
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0553:Ltbr UTSW 6 125313388 critical splice donor site probably null
R0686:Ltbr UTSW 6 125308061 missense possibly damaging 0.88
R0879:Ltbr UTSW 6 125313375 splice site probably benign
R1086:Ltbr UTSW 6 125312740 splice site probably benign
R2118:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2120:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2122:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2124:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2199:Ltbr UTSW 6 125312061 missense probably benign 0.25
R4931:Ltbr UTSW 6 125307474 splice site probably null
R5051:Ltbr UTSW 6 125312770 missense probably damaging 1.00
R5174:Ltbr UTSW 6 125309537 missense probably benign 0.00
R5268:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5269:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5357:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5358:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5360:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5361:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5363:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5434:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5436:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5441:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5442:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5533:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5534:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5859:Ltbr UTSW 6 125312808 missense probably damaging 0.98
R6702:Ltbr UTSW 6 125308068 missense probably benign 0.00
R7101:Ltbr UTSW 6 125312800 missense probably benign 0.00
R7584:Ltbr UTSW 6 125307241 missense probably benign 0.09
R7587:Ltbr UTSW 6 125312352 missense probably benign
R8798:Ltbr UTSW 6 125307295 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCTCCTGGTAGGGTGTAGAC -3'
(R):5'- GAGTGTGTGCAGAAACCTATAGC -3'

Sequencing Primer
(F):5'- CCTGGTAGGGTGTAGACAGCTC -3'
(R):5'- TGGGGCACAGCTGTAATCC -3'
Posted On2018-02-27