Incidental Mutation 'R6217:Olfr181'
ID503806
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Nameolfactory receptor 181
SynonymsMOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission 044350-MU
Accession Numbers

Genbank: NM_146999

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6217 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58924707-58928755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58926514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000145877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
Predicted Effect probably benign
Transcript: ENSMUST00000075361
AA Change: D19G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: D19G

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
AA Change: D19G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000205742
AA Change: D19G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000205986
AA Change: D19G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214942
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,926,085 P118S possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adamts20 T C 15: 94,338,715 D808G probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arsk T A 13: 76,091,816 Q46L unknown Het
Asnsd1 A G 1: 53,348,028 F147L probably benign Het
Atp5a1 T A 18: 77,781,356 S427T probably benign Het
Atp6v1b2 A C 8: 69,109,878 probably null Het
AU021092 T A 16: 5,212,186 T322S possibly damaging Het
Bcl7c A T 7: 127,708,526 M1K probably null Het
Cacna1i T C 15: 80,389,132 V1673A probably damaging Het
Ccdc146 A T 5: 21,317,902 probably null Het
Cdc7 A G 5: 106,972,794 D122G probably damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Chd3 T A 11: 69,345,535 Q1950L probably damaging Het
Cutc T C 19: 43,759,997 L111S probably damaging Het
Cyp2j6 A G 4: 96,518,161 F458L probably damaging Het
Ddhd1 T C 14: 45,619,514 probably null Het
Dstyk T C 1: 132,459,939 S804P probably damaging Het
Ech1 A G 7: 28,831,836 D283G possibly damaging Het
Exosc10 A G 4: 148,582,311 probably null Het
Fam160b2 T C 14: 70,591,758 probably null Het
Fancg A C 4: 43,010,084 V5G probably benign Het
Fbxo11 A G 17: 88,008,904 V394A probably benign Het
Fcmr C T 1: 130,878,323 R339W probably damaging Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Gab1 A G 8: 80,791,608 V125A possibly damaging Het
Gabrr1 A T 4: 33,149,026 probably null Het
Gon4l T C 3: 88,892,661 V871A possibly damaging Het
Hspg2 A G 4: 137,540,248 T2056A probably damaging Het
Lrrc3 T A 10: 77,901,009 T198S probably benign Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Ltbr C T 6: 125,307,454 V342M probably damaging Het
Muc16 A T 9: 18,655,446 S1926T unknown Het
Ntn1 C A 11: 68,213,332 V497F possibly damaging Het
Olfr700 A T 7: 106,806,072 L130Q probably damaging Het
Olfr936 A T 9: 39,046,743 *270R probably null Het
Osmr T C 15: 6,823,566 Y615C probably damaging Het
Pcdhgb2 T C 18: 37,690,001 V15A possibly damaging Het
Pkd2l2 A G 18: 34,414,680 N162S probably benign Het
Ppp1r12a G A 10: 108,240,184 probably null Het
Prtg C T 9: 72,904,794 P899S probably damaging Het
Ptprn A T 1: 75,248,166 S912R probably damaging Het
Rex2 A G 4: 147,057,474 T140A possibly damaging Het
Ryr2 T G 13: 11,834,078 D339A probably damaging Het
Sf3b1 C T 1: 55,007,518 R289H probably damaging Het
Slc17a9 A G 2: 180,737,662 D309G probably benign Het
Slc4a10 A G 2: 62,303,951 R1004G probably benign Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Syne1 C T 10: 5,293,761 G2801D probably benign Het
Tenm3 A T 8: 48,293,665 V1026D probably damaging Het
Ticam1 A T 17: 56,270,730 I455N probably damaging Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Ubn1 A G 16: 5,077,232 E714G probably damaging Het
Ush2a T G 1: 188,743,454 probably null Het
Usp19 G A 9: 108,500,144 V874M probably damaging Het
Vmn2r106 T C 17: 20,268,239 T633A probably benign Het
Vmn2r75 A T 7: 86,166,167 probably benign Het
Zfyve27 T C 19: 42,189,577 V386A probably damaging Het
Zscan20 A T 4: 128,604,534 W24R probably damaging Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2404:Olfr181 UTSW 16 58925635 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4022:Olfr181 UTSW 16 58926120 missense possibly damaging 0.94
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5109:Olfr181 UTSW 16 58926059 missense probably benign 0.10
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5477:Olfr181 UTSW 16 58926030 missense possibly damaging 0.61
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5809:Olfr181 UTSW 16 58926497 missense probably benign
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7376:Olfr181 UTSW 16 58925758 missense possibly damaging 0.82
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
R8153:Olfr181 UTSW 16 58925786 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- AGCATCTTGGGAGTGATGGC -3'
(R):5'- ATGACCTATCCTGGGCTTGC -3'

Sequencing Primer
(F):5'- CACAGGAGCAGCAGGAGTCC -3'
(R):5'- GCTTGCTGCTCTTCTGGAGAC -3'
Posted On2018-02-27