Incidental Mutation 'R6217:Ticam1'
ID503808
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
MMRRC Submission 044350-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6217 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56270730 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 455 (I455N)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably damaging
Transcript: ENSMUST00000058136
AA Change: I455N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: I455N

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Meta Mutation Damage Score 0.5211 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,926,085 P118S possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adamts20 T C 15: 94,338,715 D808G probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arsk T A 13: 76,091,816 Q46L unknown Het
Asnsd1 A G 1: 53,348,028 F147L probably benign Het
Atp5a1 T A 18: 77,781,356 S427T probably benign Het
Atp6v1b2 A C 8: 69,109,878 probably null Het
AU021092 T A 16: 5,212,186 T322S possibly damaging Het
Bcl7c A T 7: 127,708,526 M1K probably null Het
Cacna1i T C 15: 80,389,132 V1673A probably damaging Het
Ccdc146 A T 5: 21,317,902 probably null Het
Cdc7 A G 5: 106,972,794 D122G probably damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Chd3 T A 11: 69,345,535 Q1950L probably damaging Het
Cutc T C 19: 43,759,997 L111S probably damaging Het
Cyp2j6 A G 4: 96,518,161 F458L probably damaging Het
Ddhd1 T C 14: 45,619,514 probably null Het
Dstyk T C 1: 132,459,939 S804P probably damaging Het
Ech1 A G 7: 28,831,836 D283G possibly damaging Het
Exosc10 A G 4: 148,582,311 probably null Het
Fam160b2 T C 14: 70,591,758 probably null Het
Fancg A C 4: 43,010,084 V5G probably benign Het
Fbxo11 A G 17: 88,008,904 V394A probably benign Het
Fcmr C T 1: 130,878,323 R339W probably damaging Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Gab1 A G 8: 80,791,608 V125A possibly damaging Het
Gabrr1 A T 4: 33,149,026 probably null Het
Gon4l T C 3: 88,892,661 V871A possibly damaging Het
Hspg2 A G 4: 137,540,248 T2056A probably damaging Het
Lrrc3 T A 10: 77,901,009 T198S probably benign Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Ltbr C T 6: 125,307,454 V342M probably damaging Het
Muc16 A T 9: 18,655,446 S1926T unknown Het
Ntn1 C A 11: 68,213,332 V497F possibly damaging Het
Olfr181 T C 16: 58,926,514 D19G probably benign Het
Olfr700 A T 7: 106,806,072 L130Q probably damaging Het
Olfr936 A T 9: 39,046,743 *270R probably null Het
Osmr T C 15: 6,823,566 Y615C probably damaging Het
Pcdhgb2 T C 18: 37,690,001 V15A possibly damaging Het
Pkd2l2 A G 18: 34,414,680 N162S probably benign Het
Ppp1r12a G A 10: 108,240,184 probably null Het
Prtg C T 9: 72,904,794 P899S probably damaging Het
Ptprn A T 1: 75,248,166 S912R probably damaging Het
Rex2 A G 4: 147,057,474 T140A possibly damaging Het
Ryr2 T G 13: 11,834,078 D339A probably damaging Het
Sf3b1 C T 1: 55,007,518 R289H probably damaging Het
Slc17a9 A G 2: 180,737,662 D309G probably benign Het
Slc4a10 A G 2: 62,303,951 R1004G probably benign Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Syne1 C T 10: 5,293,761 G2801D probably benign Het
Tenm3 A T 8: 48,293,665 V1026D probably damaging Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Ubn1 A G 16: 5,077,232 E714G probably damaging Het
Ush2a T G 1: 188,743,454 probably null Het
Usp19 G A 9: 108,500,144 V874M probably damaging Het
Vmn2r106 T C 17: 20,268,239 T633A probably benign Het
Vmn2r75 A T 7: 86,166,167 probably benign Het
Zfyve27 T C 19: 42,189,577 V386A probably damaging Het
Zscan20 A T 4: 128,604,534 W24R probably damaging Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
R7684:Ticam1 UTSW 17 56269984 missense unknown
R7755:Ticam1 UTSW 17 56270182 missense unknown
R7885:Ticam1 UTSW 17 56271067 missense probably benign 0.04
R8021:Ticam1 UTSW 17 56270089 missense unknown
R8414:Ticam1 UTSW 17 56271340 missense probably benign 0.00
R8822:Ticam1 UTSW 17 56271444 missense probably damaging 1.00
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTCATCCAGCCACACAATG -3'
(R):5'- CCTGTTTTGGACCACTCAGAAAC -3'

Sequencing Primer
(F):5'- GCTGTGGAGCAGTCTGG -3'
(R):5'- GTTTTGGACCACTCAGAAACATCTG -3'
Posted On2018-02-27