Incidental Mutation 'R6217:Atp5a1'
ID503812
Institutional Source Beutler Lab
Gene Symbol Atp5a1
Ensembl Gene ENSMUSG00000025428
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1
SynonymsAtpm, Mom2, D18Ertd206e
MMRRC Submission 044350-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6217 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location77773729-77782869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77781356 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 427 (S427T)
Ref Sequence ENSEMBL: ENSMUSP00000110396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026495] [ENSMUST00000114748] [ENSMUST00000135678]
Predicted Effect probably benign
Transcript: ENSMUST00000026495
AA Change: S477T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026495
Gene: ENSMUSG00000025428
AA Change: S477T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
Pfam:ATP-synt_ab_N 67 135 3.4e-17 PFAM
Pfam:ATP-synt_ab 192 415 5.7e-76 PFAM
Pfam:ATP-synt_ab_C 427 528 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114748
AA Change: S427T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110396
Gene: ENSMUSG00000025428
AA Change: S427T

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 17 85 1.1e-19 PFAM
Pfam:ATP-synt_ab 141 365 4.8e-75 PFAM
Pfam:ATP-synt_ab_C 377 479 2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128073
Predicted Effect probably benign
Transcript: ENSMUST00000135678
SMART Domains Protein: ENSMUSP00000120436
Gene: ENSMUSG00000025428

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
PDB:2W6J|C 22 78 5e-27 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146869
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a targeted mutation of this gene display preweaning and embryonic lethality. Heterozygous mutants exhibit decreased body weight and lean body mass and reduced circulating insulin, serum albumin, and total protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik G A 6: 40,926,085 P118S possibly damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Adamts20 T C 15: 94,338,715 D808G probably benign Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arsk T A 13: 76,091,816 Q46L unknown Het
Asnsd1 A G 1: 53,348,028 F147L probably benign Het
Atp6v1b2 A C 8: 69,109,878 probably null Het
AU021092 T A 16: 5,212,186 T322S possibly damaging Het
Bcl7c A T 7: 127,708,526 M1K probably null Het
Cacna1i T C 15: 80,389,132 V1673A probably damaging Het
Ccdc146 A T 5: 21,317,902 probably null Het
Cdc7 A G 5: 106,972,794 D122G probably damaging Het
Cfap46 CCTTCTTCT CCTTCT 7: 139,638,900 probably benign Het
Chd3 T A 11: 69,345,535 Q1950L probably damaging Het
Cutc T C 19: 43,759,997 L111S probably damaging Het
Cyp2j6 A G 4: 96,518,161 F458L probably damaging Het
Ddhd1 T C 14: 45,619,514 probably null Het
Dstyk T C 1: 132,459,939 S804P probably damaging Het
Ech1 A G 7: 28,831,836 D283G possibly damaging Het
Exosc10 A G 4: 148,582,311 probably null Het
Fam160b2 T C 14: 70,591,758 probably null Het
Fancg A C 4: 43,010,084 V5G probably benign Het
Fbxo11 A G 17: 88,008,904 V394A probably benign Het
Fcmr C T 1: 130,878,323 R339W probably damaging Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Gab1 A G 8: 80,791,608 V125A possibly damaging Het
Gabrr1 A T 4: 33,149,026 probably null Het
Gon4l T C 3: 88,892,661 V871A possibly damaging Het
Hspg2 A G 4: 137,540,248 T2056A probably damaging Het
Lrrc3 T A 10: 77,901,009 T198S probably benign Het
Lsamp A T 16: 42,134,312 E174V possibly damaging Het
Ltbr C T 6: 125,307,454 V342M probably damaging Het
Muc16 A T 9: 18,655,446 S1926T unknown Het
Ntn1 C A 11: 68,213,332 V497F possibly damaging Het
Olfr181 T C 16: 58,926,514 D19G probably benign Het
Olfr700 A T 7: 106,806,072 L130Q probably damaging Het
Olfr936 A T 9: 39,046,743 *270R probably null Het
Osmr T C 15: 6,823,566 Y615C probably damaging Het
Pcdhgb2 T C 18: 37,690,001 V15A possibly damaging Het
Pkd2l2 A G 18: 34,414,680 N162S probably benign Het
Ppp1r12a G A 10: 108,240,184 probably null Het
Prtg C T 9: 72,904,794 P899S probably damaging Het
Ptprn A T 1: 75,248,166 S912R probably damaging Het
Rex2 A G 4: 147,057,474 T140A possibly damaging Het
Ryr2 T G 13: 11,834,078 D339A probably damaging Het
Sf3b1 C T 1: 55,007,518 R289H probably damaging Het
Slc17a9 A G 2: 180,737,662 D309G probably benign Het
Slc4a10 A G 2: 62,303,951 R1004G probably benign Het
Sprr2f A T 3: 92,366,059 Q55L unknown Het
Syne1 C T 10: 5,293,761 G2801D probably benign Het
Tenm3 A T 8: 48,293,665 V1026D probably damaging Het
Ticam1 A T 17: 56,270,730 I455N probably damaging Het
Tmem161b A G 13: 84,251,244 I6M possibly damaging Het
Ubn1 A G 16: 5,077,232 E714G probably damaging Het
Ush2a T G 1: 188,743,454 probably null Het
Usp19 G A 9: 108,500,144 V874M probably damaging Het
Vmn2r106 T C 17: 20,268,239 T633A probably benign Het
Vmn2r75 A T 7: 86,166,167 probably benign Het
Zfyve27 T C 19: 42,189,577 V386A probably damaging Het
Zscan20 A T 4: 128,604,534 W24R probably damaging Het
Other mutations in Atp5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Atp5a1 APN 18 77777533 missense probably damaging 1.00
IGL01536:Atp5a1 APN 18 77780312 intron probably benign
IGL01585:Atp5a1 APN 18 77781058 missense possibly damaging 0.95
IGL02973:Atp5a1 APN 18 77780149 missense probably damaging 1.00
R0268:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0344:Atp5a1 UTSW 18 77780195 missense probably damaging 0.96
R0399:Atp5a1 UTSW 18 77781836 nonsense probably null
R0464:Atp5a1 UTSW 18 77779922 missense probably benign 0.04
R1471:Atp5a1 UTSW 18 77781269 missense probably damaging 1.00
R1476:Atp5a1 UTSW 18 77781925 missense probably benign 0.00
R1630:Atp5a1 UTSW 18 77777567 missense possibly damaging 0.94
R2102:Atp5a1 UTSW 18 77782317 missense probably damaging 0.99
R4424:Atp5a1 UTSW 18 77780066 intron probably benign
R4746:Atp5a1 UTSW 18 77778742 missense probably benign 0.00
R4864:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R5191:Atp5a1 UTSW 18 77780229 missense probably damaging 1.00
R6262:Atp5a1 UTSW 18 77781212 missense probably damaging 1.00
R6263:Atp5a1 UTSW 18 77779230 splice site probably null
R6284:Atp5a1 UTSW 18 77778468 missense probably benign 0.30
R6873:Atp5a1 UTSW 18 77775840 nonsense probably null
R7442:Atp5a1 UTSW 18 77779120 missense probably benign 0.04
R7661:Atp5a1 UTSW 18 77774102 missense possibly damaging 0.70
R7696:Atp5a1 UTSW 18 77780986 missense probably damaging 1.00
R7846:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
R7929:Atp5a1 UTSW 18 77781315 missense possibly damaging 0.84
X0021:Atp5a1 UTSW 18 77781273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTCTTTGACACAGGAGTTTG -3'
(R):5'- CTGGCAGTGTTACACAGCATTTG -3'

Sequencing Primer
(F):5'- TGACACAGGAGTTTGTTACTAGC -3'
(R):5'- ACAGCATTTGTGGTGTAATTTGTCAC -3'
Posted On2018-02-27