Incidental Mutation 'R6218:Tnr'
ID 503818
Institutional Source Beutler Lab
Gene Symbol Tnr
Ensembl Gene ENSMUSG00000015829
Gene Name tenascin R
Synonyms TN-R, janusin, restrictin, J1-tenascin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 159523769-159931729 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 159888314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 882 (V882A)
Ref Sequence ENSEMBL: ENSMUSP00000141553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069]
AlphaFold Q8BYI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000111669
AA Change: V882A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: V882A

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192069
AA Change: V882A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: V882A

DomainStartEndE-ValueType
EGF_like 203 231 3.87e1 SMART
EGF_like 234 262 3.16e1 SMART
EGF_like 265 293 2.8e1 SMART
EGF 296 324 2.43e1 SMART
FN3 326 404 4.77e-8 SMART
FN3 415 493 3.1e-7 SMART
FN3 504 583 2.01e-6 SMART
FN3 594 675 1.98e-5 SMART
FN3 686 763 3.29e-11 SMART
FN3 774 851 3.32e-7 SMART
FN3 864 942 3.73e-10 SMART
FN3 953 1031 2.28e-5 SMART
FN3 1041 1118 8.56e-10 SMART
FBG 1133 1343 2.69e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Tnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tnr APN 1 159861245 missense probably benign 0.00
IGL00905:Tnr APN 1 159852182 missense probably benign 0.06
IGL01396:Tnr APN 1 159897024 missense possibly damaging 0.91
IGL01550:Tnr APN 1 159874258 missense probably benign
IGL01803:Tnr APN 1 159868243 missense probably damaging 1.00
IGL01845:Tnr APN 1 159868006 unclassified probably benign
IGL01983:Tnr APN 1 159863779 missense probably benign 0.00
IGL01985:Tnr APN 1 159919037 missense possibly damaging 0.70
IGL02210:Tnr APN 1 159852101 missense probably benign 0.44
IGL02486:Tnr APN 1 159852094 splice site probably null
IGL03210:Tnr APN 1 159888310 missense probably benign 0.00
Assiduous UTSW 1 159892023 missense probably benign
Persistent UTSW 1 159852286 missense probably benign
Tenacious UTSW 1 159874200 missense probably damaging 1.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0002:Tnr UTSW 1 159874200 missense probably damaging 1.00
R0009:Tnr UTSW 1 159852416 missense probably damaging 1.00
R0042:Tnr UTSW 1 159887025 missense probably benign 0.01
R0594:Tnr UTSW 1 159850335 missense probably benign
R0617:Tnr UTSW 1 159868103 missense probably damaging 1.00
R0637:Tnr UTSW 1 159850335 missense possibly damaging 0.60
R0682:Tnr UTSW 1 159852307 nonsense probably null
R1171:Tnr UTSW 1 159858210 missense probably damaging 0.97
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1185:Tnr UTSW 1 159852286 missense probably benign
R1335:Tnr UTSW 1 159868030 missense probably benign 0.18
R1540:Tnr UTSW 1 159850105 missense probably damaging 0.99
R1697:Tnr UTSW 1 159852030 missense probably benign 0.00
R1938:Tnr UTSW 1 159895037 nonsense probably null
R1941:Tnr UTSW 1 159850134 missense possibly damaging 0.92
R2021:Tnr UTSW 1 159852022 missense probably benign
R2022:Tnr UTSW 1 159852022 missense probably benign
R2051:Tnr UTSW 1 159892033 missense probably benign
R2157:Tnr UTSW 1 159858270 missense probably damaging 0.98
R2319:Tnr UTSW 1 159850048 start codon destroyed probably null 1.00
R2936:Tnr UTSW 1 159888362 missense probably damaging 0.96
R3015:Tnr UTSW 1 159888259 missense probably benign 0.00
R3417:Tnr UTSW 1 159895042 missense probably benign 0.00
R3739:Tnr UTSW 1 159923413 missense possibly damaging 0.78
R3977:Tnr UTSW 1 159892023 missense probably benign
R4232:Tnr UTSW 1 159886215 missense possibly damaging 0.55
R4478:Tnr UTSW 1 159884756 splice site probably null
R4774:Tnr UTSW 1 159897066 missense probably damaging 1.00
R4829:Tnr UTSW 1 159858404 missense probably benign 0.24
R4837:Tnr UTSW 1 159684788 intron probably benign
R5111:Tnr UTSW 1 159886228 missense probably benign 0.04
R5224:Tnr UTSW 1 159923315 missense probably damaging 1.00
R5249:Tnr UTSW 1 159684656 intron probably benign
R5730:Tnr UTSW 1 159888322 missense probably benign 0.02
R5807:Tnr UTSW 1 159886930 missense possibly damaging 0.95
R5832:Tnr UTSW 1 159886122 missense probably benign 0.15
R5927:Tnr UTSW 1 159912766 missense probably damaging 1.00
R6049:Tnr UTSW 1 159912754 missense probably damaging 1.00
R6056:Tnr UTSW 1 159886909 missense probably damaging 0.99
R6063:Tnr UTSW 1 159912684 missense probably benign 0.00
R6141:Tnr UTSW 1 159887122 missense probably benign
R6275:Tnr UTSW 1 159861270 missense probably damaging 0.99
R6543:Tnr UTSW 1 159924107 missense probably damaging 1.00
R6626:Tnr UTSW 1 159850252 missense probably damaging 1.00
R7378:Tnr UTSW 1 159884862 critical splice donor site probably null
R7587:Tnr UTSW 1 159886208 missense probably benign 0.27
R7766:Tnr UTSW 1 159888310 missense probably benign 0.00
R8140:Tnr UTSW 1 159863695 missense probably damaging 0.99
R8215:Tnr UTSW 1 159888290 missense possibly damaging 0.91
R8248:Tnr UTSW 1 159892093 missense probably damaging 0.98
R8374:Tnr UTSW 1 159858383 missense probably benign 0.24
R8427:Tnr UTSW 1 159886231 missense possibly damaging 0.67
R8465:Tnr UTSW 1 159886075 missense probably benign 0.01
R8534:Tnr UTSW 1 159919015 missense probably benign 0.18
R8753:Tnr UTSW 1 159850366 missense probably benign 0.28
R8804:Tnr UTSW 1 159858312 missense probably benign
R8857:Tnr UTSW 1 159886158 missense probably benign 0.10
R8917:Tnr UTSW 1 159874122 nonsense probably null
R8930:Tnr UTSW 1 159912789 missense probably damaging 1.00
R8932:Tnr UTSW 1 159912789 missense probably damaging 1.00
R8940:Tnr UTSW 1 159858297 missense probably damaging 1.00
R9096:Tnr UTSW 1 159850234 missense probably benign 0.10
R9127:Tnr UTSW 1 159886110 missense possibly damaging 0.68
R9205:Tnr UTSW 1 159895047 missense probably benign
R9311:Tnr UTSW 1 159850093 missense probably benign 0.30
X0011:Tnr UTSW 1 159889338 missense probably benign 0.02
X0028:Tnr UTSW 1 159874114 missense probably damaging 1.00
Z1088:Tnr UTSW 1 159895095 missense probably benign 0.29
Z1177:Tnr UTSW 1 159852091 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTAGGGTCATGCCTGCCTG -3'
(R):5'- AAGTTGGTGAACTCATGGTTTCTC -3'

Sequencing Primer
(F):5'- CCTGAGGGACACTAGTGGATC -3'
(R):5'- CACTCTCATTTTGAGGAAGTATGG -3'
Posted On 2018-02-27