Mutagenetix > Incidental Mutation

Incidental Mutation 'R6218:Tnr'

503818

Institutional Source

Beutler Lab

Gene Symbol

Tnr

Ensembl Gene

ENSMUSG00000015829

Gene Name

tenascin R

Synonyms

TN-R, janusin, restrictin, J1-tenascin

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

159523769-159931729 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 159888314 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 882 (V882A)

Ref Sequence

ENSEMBL: ENSMUSP00000141553 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111669] [ENSMUST00000192069]

AlphaFold

Q8BYI9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111669
AA Change: V882A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000107298
Gene: ENSMUSG00000015829
AA Change: V882A

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192069
AA Change: V882A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141553
Gene: ENSMUSG00000015829
AA Change: V882A

Domain	Start	End	E-Value	Type
EGF_like	203	231	3.87e1	SMART
EGF_like	234	262	3.16e1	SMART
EGF_like	265	293	2.8e1	SMART
EGF	296	324	2.43e1	SMART
FN3	326	404	4.77e-8	SMART
FN3	415	493	3.1e-7	SMART
FN3	504	583	2.01e-6	SMART
FN3	594	675	1.98e-5	SMART
FN3	686	763	3.29e-11	SMART
FN3	774	851	3.32e-7	SMART
FN3	864	942	3.73e-10	SMART
FN3	953	1031	2.28e-5	SMART
FN3	1041	1118	8.56e-10	SMART
FBG	1133	1343	2.69e-133	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tenascin family of extracellular matrix glycoproteins. The encoded protein is restricted to the central nervous system. The protein may play a role in neurite outgrowth, neural cell adhesion and modulation of sodium channel function. It is a constituent of perineuronal nets. [provided by RefSeq, Aug 2013]
PHENOTYPE: In spite of having decreased conduction velocity in the optic nerve and ultrastrucural alterations within the hippocampus, homozygous null mice are viable, fertile, and display normal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
Dzip3	A	T	16: 48,958,465	M323K	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Galnt2	A	G	8: 124,343,315	I524V	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Grip1	T	C	10: 119,986,346	S405P	possibly damaging	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
L3mbtl3	T	C	10: 26,292,747	I595V	unknown	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Map1b	A	T	13: 99,433,206	D1002E	unknown	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Ss18l1	G	A	2: 180,055,112	V109I	probably benign	Het
Tbx5	C	T	5: 119,853,598	H245Y	probably damaging	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in Tnr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Tnr	APN	1	159861245	missense	probably benign	0.00
IGL00905:Tnr	APN	1	159852182	missense	probably benign	0.06
IGL01396:Tnr	APN	1	159897024	missense	possibly damaging	0.91
IGL01550:Tnr	APN	1	159874258	missense	probably benign
IGL01803:Tnr	APN	1	159868243	missense	probably damaging	1.00
IGL01845:Tnr	APN	1	159868006	unclassified	probably benign
IGL01983:Tnr	APN	1	159863779	missense	probably benign	0.00
IGL01985:Tnr	APN	1	159919037	missense	possibly damaging	0.70
IGL02210:Tnr	APN	1	159852101	missense	probably benign	0.44
IGL02486:Tnr	APN	1	159852094	splice site	probably null
IGL03210:Tnr	APN	1	159888310	missense	probably benign	0.00
Assiduous	UTSW	1	159892023	missense	probably benign
Grip	UTSW	1	159886110	missense	possibly damaging	0.68
Persistent	UTSW	1	159852286	missense	probably benign
Tenacious	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0002:Tnr	UTSW	1	159874200	missense	probably damaging	1.00
R0009:Tnr	UTSW	1	159852416	missense	probably damaging	1.00
R0042:Tnr	UTSW	1	159887025	missense	probably benign	0.01
R0594:Tnr	UTSW	1	159850335	missense	probably benign
R0617:Tnr	UTSW	1	159868103	missense	probably damaging	1.00
R0637:Tnr	UTSW	1	159850335	missense	possibly damaging	0.60
R0682:Tnr	UTSW	1	159852307	nonsense	probably null
R1171:Tnr	UTSW	1	159858210	missense	probably damaging	0.97
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1185:Tnr	UTSW	1	159852286	missense	probably benign
R1335:Tnr	UTSW	1	159868030	missense	probably benign	0.18
R1540:Tnr	UTSW	1	159850105	missense	probably damaging	0.99
R1697:Tnr	UTSW	1	159852030	missense	probably benign	0.00
R1938:Tnr	UTSW	1	159895037	nonsense	probably null
R1941:Tnr	UTSW	1	159850134	missense	possibly damaging	0.92
R2021:Tnr	UTSW	1	159852022	missense	probably benign
R2022:Tnr	UTSW	1	159852022	missense	probably benign
R2051:Tnr	UTSW	1	159892033	missense	probably benign
R2157:Tnr	UTSW	1	159858270	missense	probably damaging	0.98
R2319:Tnr	UTSW	1	159850048	start codon destroyed	probably null	1.00
R2936:Tnr	UTSW	1	159888362	missense	probably damaging	0.96
R3015:Tnr	UTSW	1	159888259	missense	probably benign	0.00
R3417:Tnr	UTSW	1	159895042	missense	probably benign	0.00
R3739:Tnr	UTSW	1	159923413	missense	possibly damaging	0.78
R3977:Tnr	UTSW	1	159892023	missense	probably benign
R4232:Tnr	UTSW	1	159886215	missense	possibly damaging	0.55
R4478:Tnr	UTSW	1	159884756	splice site	probably null
R4774:Tnr	UTSW	1	159897066	missense	probably damaging	1.00
R4829:Tnr	UTSW	1	159858404	missense	probably benign	0.24
R4837:Tnr	UTSW	1	159684788	intron	probably benign
R5111:Tnr	UTSW	1	159886228	missense	probably benign	0.04
R5224:Tnr	UTSW	1	159923315	missense	probably damaging	1.00
R5249:Tnr	UTSW	1	159684656	intron	probably benign
R5730:Tnr	UTSW	1	159888322	missense	probably benign	0.02
R5807:Tnr	UTSW	1	159886930	missense	possibly damaging	0.95
R5832:Tnr	UTSW	1	159886122	missense	probably benign	0.15
R5927:Tnr	UTSW	1	159912766	missense	probably damaging	1.00
R6049:Tnr	UTSW	1	159912754	missense	probably damaging	1.00
R6056:Tnr	UTSW	1	159886909	missense	probably damaging	0.99
R6063:Tnr	UTSW	1	159912684	missense	probably benign	0.00
R6141:Tnr	UTSW	1	159887122	missense	probably benign
R6275:Tnr	UTSW	1	159861270	missense	probably damaging	0.99
R6543:Tnr	UTSW	1	159924107	missense	probably damaging	1.00
R6626:Tnr	UTSW	1	159850252	missense	probably damaging	1.00
R7378:Tnr	UTSW	1	159884862	critical splice donor site	probably null
R7587:Tnr	UTSW	1	159886208	missense	probably benign	0.27
R7766:Tnr	UTSW	1	159888310	missense	probably benign	0.00
R8140:Tnr	UTSW	1	159863695	missense	probably damaging	0.99
R8215:Tnr	UTSW	1	159888290	missense	possibly damaging	0.91
R8248:Tnr	UTSW	1	159892093	missense	probably damaging	0.98
R8374:Tnr	UTSW	1	159858383	missense	probably benign	0.24
R8427:Tnr	UTSW	1	159886231	missense	possibly damaging	0.67
R8465:Tnr	UTSW	1	159886075	missense	probably benign	0.01
R8534:Tnr	UTSW	1	159919015	missense	probably benign	0.18
R8753:Tnr	UTSW	1	159850366	missense	probably benign	0.28
R8804:Tnr	UTSW	1	159858312	missense	probably benign
R8857:Tnr	UTSW	1	159886158	missense	probably benign	0.10
R8917:Tnr	UTSW	1	159874122	nonsense	probably null
R8930:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8932:Tnr	UTSW	1	159912789	missense	probably damaging	1.00
R8940:Tnr	UTSW	1	159858297	missense	probably damaging	1.00
R9096:Tnr	UTSW	1	159850234	missense	probably benign	0.10
R9127:Tnr	UTSW	1	159886110	missense	possibly damaging	0.68
R9205:Tnr	UTSW	1	159895047	missense	probably benign
R9311:Tnr	UTSW	1	159850093	missense	probably benign	0.30
R9679:Tnr	UTSW	1	159892038	missense	probably benign	0.08
X0011:Tnr	UTSW	1	159889338	missense	probably benign	0.02
X0028:Tnr	UTSW	1	159874114	missense	probably damaging	1.00
Z1088:Tnr	UTSW	1	159895095	missense	probably benign	0.29
Z1177:Tnr	UTSW	1	159852091	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGTAGGGTCATGCCTGCCTG -3'
(R):5'- AAGTTGGTGAACTCATGGTTTCTC -3'

Sequencing Primer
(F):5'- CCTGAGGGACACTAGTGGATC -3'
(R):5'- CACTCTCATTTTGAGGAAGTATGG -3'

Posted On

2018-02-27