Incidental Mutation 'R6218:Large2'
ID 503822
Institutional Source Beutler Lab
Gene Symbol Large2
Ensembl Gene ENSMUSG00000040434
Gene Name LARGE xylosyl- and glucuronyltransferase 2
Synonyms 5730485C17Rik, Gyltl1b
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 92195391-92201437 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92200981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000135619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028650] [ENSMUST00000068586] [ENSMUST00000090582] [ENSMUST00000111284] [ENSMUST00000148352] [ENSMUST00000176289] [ENSMUST00000176339] [ENSMUST00000176774] [ENSMUST00000176810]
AlphaFold Q5XPT3
Predicted Effect probably benign
Transcript: ENSMUST00000028650
SMART Domains Protein: ENSMUSP00000028650
Gene: ENSMUSG00000027222

DomainStartEndE-ValueType
Pfam:Pex16 9 329 1.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068586
AA Change: D43G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090582
AA Change: D43G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111284
AA Change: D68G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434
AA Change: D68G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146311
Predicted Effect possibly damaging
Transcript: ENSMUST00000148352
AA Change: D43G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148386
Predicted Effect probably benign
Transcript: ENSMUST00000176289
AA Change: D43G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176339
AA Change: D65G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434
AA Change: D65G

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176774
AA Change: D43G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176810
AA Change: D68G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434
AA Change: D68G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Null mutant mice are healthy and are indistinguishable from control littermates with respect to body weight and life span when aged up to one year. No increased spontaneous tumor load was observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,728,730 (GRCm39) Q38K probably benign Het
9930111J21Rik2 A T 11: 48,910,134 (GRCm39) N766K probably benign Het
Adam15 A C 3: 89,251,190 (GRCm39) I505S probably benign Het
Apc2 T C 10: 80,142,254 (GRCm39) M391T probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bclaf1 A G 10: 20,210,374 (GRCm39) S840G probably benign Het
Cacna2d4 A G 6: 119,216,021 (GRCm39) Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,724,863 (GRCm39) probably null Het
Ddhd1 A G 14: 45,851,633 (GRCm39) L141P probably damaging Het
Dnaaf3 A T 7: 4,526,671 (GRCm39) S469T probably benign Het
Dzip3 A T 16: 48,778,828 (GRCm39) M323K possibly damaging Het
Eci2 T A 13: 35,177,048 (GRCm39) probably null Het
Fam227b A T 2: 125,968,882 (GRCm39) V64E probably damaging Het
Galnt2 A G 8: 125,070,054 (GRCm39) I524V probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm3443 T A 19: 21,533,110 (GRCm39) S25T probably damaging Het
Gpr22 T A 12: 31,761,616 (GRCm39) K14* probably null Het
Grip1 T C 10: 119,822,251 (GRCm39) S405P possibly damaging Het
Helz2 T C 2: 180,877,738 (GRCm39) H1020R probably damaging Het
Helz2 C A 2: 180,874,087 (GRCm39) V2136L probably benign Het
Il36rn G A 2: 24,167,502 (GRCm39) probably benign Het
Iqsec1 T A 6: 90,666,617 (GRCm39) S607C probably damaging Het
Irag1 G A 7: 110,476,112 (GRCm39) T819M probably benign Het
Klhl2 A T 8: 65,205,801 (GRCm39) Y373* probably null Het
L3mbtl3 T C 10: 26,168,645 (GRCm39) I595V unknown Het
Lrrfip1 T C 1: 91,009,881 (GRCm39) Y122H probably damaging Het
Map1b A T 13: 99,569,714 (GRCm39) D1002E unknown Het
Mink1 C T 11: 70,489,720 (GRCm39) T59I possibly damaging Het
Myo7b T C 18: 32,092,507 (GRCm39) N2097D probably benign Het
Nbea C A 3: 55,535,905 (GRCm39) C2893F probably damaging Het
Nlgn1 A T 3: 25,490,257 (GRCm39) V490E probably damaging Het
Or2w1b G A 13: 21,300,401 (GRCm39) E180K probably damaging Het
Or2y3 A G 17: 38,393,620 (GRCm39) M83T probably damaging Het
Or4c123 G T 2: 89,127,306 (GRCm39) H103N probably damaging Het
Or4f62 T C 2: 111,986,701 (GRCm39) I135T probably damaging Het
Or4k2 C A 14: 50,424,135 (GRCm39) D180Y probably damaging Het
Pctp A G 11: 89,878,144 (GRCm39) I130T probably benign Het
Pdcl3 T C 1: 39,027,152 (GRCm39) probably null Het
Pheta2 T A 15: 82,227,917 (GRCm39) H145Q probably benign Het
Pira12 A T 7: 3,897,031 (GRCm39) S602T possibly damaging Het
Pkp1 T C 1: 135,807,646 (GRCm39) K541E probably damaging Het
Plekhh2 G A 17: 84,898,992 (GRCm39) V990I probably benign Het
Ppp1r3a A T 6: 14,718,430 (GRCm39) V828D probably damaging Het
Prrc2b T C 2: 32,098,823 (GRCm39) Y712H probably damaging Het
Prune2 T C 19: 17,098,926 (GRCm39) S1477P probably benign Het
Psma5 A G 3: 108,187,118 (GRCm39) K239R probably benign Het
Rhobtb1 G C 10: 69,106,286 (GRCm39) A284P probably benign Het
Samsn1 G A 16: 75,742,162 (GRCm39) noncoding transcript Het
Scel A G 14: 103,809,478 (GRCm39) T273A probably benign Het
Slc22a5 T A 11: 53,782,444 (GRCm39) probably benign Het
Slc25a37 A T 14: 69,486,953 (GRCm39) M110K possibly damaging Het
Slc6a2 A T 8: 93,708,609 (GRCm39) M242L probably benign Het
Slc8a3 C A 12: 81,246,341 (GRCm39) W904L probably benign Het
Ss18l1 G A 2: 179,696,905 (GRCm39) V109I probably benign Het
Tbx5 C T 5: 119,991,663 (GRCm39) H245Y probably damaging Het
Thumpd2 C A 17: 81,360,342 (GRCm39) L244F probably damaging Het
Tmem107 T A 11: 68,962,241 (GRCm39) V66E probably damaging Het
Tnr T C 1: 159,715,884 (GRCm39) V882A possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttbk1 A G 17: 46,781,733 (GRCm39) V340A possibly damaging Het
Veph1 T C 3: 66,162,481 (GRCm39) E59G probably damaging Het
Vmn1r234 T A 17: 21,449,983 (GRCm39) M299K possibly damaging Het
Vps13b T C 15: 35,770,610 (GRCm39) Y2018H probably benign Het
Zbtb11 A G 16: 55,818,436 (GRCm39) E620G probably benign Het
Zfp418 A G 7: 7,185,627 (GRCm39) H530R possibly damaging Het
Zfp764l1 C T 7: 126,992,581 (GRCm39) A10T possibly damaging Het
Other mutations in Large2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Large2 APN 2 92,196,684 (GRCm39) missense probably damaging 1.00
IGL01152:Large2 APN 2 92,200,984 (GRCm39) missense probably damaging 1.00
IGL01377:Large2 APN 2 92,199,676 (GRCm39) missense probably damaging 1.00
IGL01764:Large2 APN 2 92,197,531 (GRCm39) splice site probably benign
IGL02016:Large2 APN 2 92,199,888 (GRCm39) missense possibly damaging 0.82
IGL02396:Large2 APN 2 92,196,668 (GRCm39) nonsense probably null
IGL02996:Large2 APN 2 92,196,273 (GRCm39) missense possibly damaging 0.88
IGL03011:Large2 APN 2 92,197,927 (GRCm39) missense probably damaging 1.00
egged UTSW 2 92,200,853 (GRCm39) intron probably benign
P0041:Large2 UTSW 2 92,197,599 (GRCm39) splice site probably benign
R1915:Large2 UTSW 2 92,196,170 (GRCm39) splice site probably benign
R4193:Large2 UTSW 2 92,195,704 (GRCm39) missense probably damaging 1.00
R4239:Large2 UTSW 2 92,196,950 (GRCm39) splice site probably benign
R4580:Large2 UTSW 2 92,200,957 (GRCm39) missense possibly damaging 0.66
R4679:Large2 UTSW 2 92,197,903 (GRCm39) missense probably benign 0.31
R4857:Large2 UTSW 2 92,196,979 (GRCm39) intron probably benign
R4918:Large2 UTSW 2 92,196,452 (GRCm39) intron probably benign
R5050:Large2 UTSW 2 92,198,124 (GRCm39) missense probably benign 0.05
R5237:Large2 UTSW 2 92,197,487 (GRCm39) missense probably benign 0.16
R5264:Large2 UTSW 2 92,205,088 (GRCm39) unclassified probably benign
R5508:Large2 UTSW 2 92,200,248 (GRCm39) missense possibly damaging 0.80
R5999:Large2 UTSW 2 92,196,403 (GRCm39) missense probably benign 0.01
R6077:Large2 UTSW 2 92,196,915 (GRCm39) missense probably benign 0.00
R6167:Large2 UTSW 2 92,197,433 (GRCm39) missense probably benign 0.44
R6225:Large2 UTSW 2 92,196,825 (GRCm39) missense probably damaging 1.00
R6301:Large2 UTSW 2 92,199,861 (GRCm39) missense probably damaging 1.00
R6376:Large2 UTSW 2 92,200,853 (GRCm39) intron probably benign
R6485:Large2 UTSW 2 92,196,373 (GRCm39) missense probably benign
R6727:Large2 UTSW 2 92,201,215 (GRCm39) utr 5 prime probably benign
R6942:Large2 UTSW 2 92,201,167 (GRCm39) missense probably damaging 0.99
R7051:Large2 UTSW 2 92,197,367 (GRCm39) missense probably damaging 0.97
R7318:Large2 UTSW 2 92,196,373 (GRCm39) missense probably benign
R7581:Large2 UTSW 2 92,200,538 (GRCm39) missense probably damaging 1.00
R7640:Large2 UTSW 2 92,205,050 (GRCm39) start codon destroyed probably null
R9522:Large2 UTSW 2 92,200,266 (GRCm39) missense probably damaging 1.00
Z1176:Large2 UTSW 2 92,200,543 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGGGTAGCTACATGTCAG -3'
(R):5'- AGTGCTCATCTTGCTATGGTCC -3'

Sequencing Primer
(F):5'- AGCTACATGTCAGGTGCTG -3'
(R):5'- CTGAGTCCCACAGTCATGC -3'
Posted On 2018-02-27