Mutagenetix > Incidental Mutation

Incidental Mutation 'R6218:Ss18l1'

503825

Institutional Source

Beutler Lab

Gene Symbol

Ss18l1

Ensembl Gene

ENSMUSG00000039086

Gene Name

SS18, nBAF chromatin remodeling complex subunit like 1

Synonyms

CREST, A230053O16Rik

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.282) question?

Stock #

R6218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

180042509-180070201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 180055112 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 109 (V109I)

Ref Sequence

ENSEMBL: ENSMUSP00000041288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041126]

AlphaFold

Q8BW22

Predicted Effect

probably benign
Transcript: ENSMUST00000041126
AA Change: V109I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000041288
Gene: ENSMUSG00000039086
AA Change: V109I

Domain	Start	End	E-Value	Type
Pfam:SSXT	13	74	4.3e-35	PFAM
low complexity region	85	106	N/A	INTRINSIC
low complexity region	215	238	N/A	INTRINSIC
low complexity region	244	251	N/A	INTRINSIC
low complexity region	311	375	N/A	INTRINSIC
low complexity region	390	402	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have central nervous system and coordination defects. They grow slowly and usually die before adulthood. Those that do survive are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
Dzip3	A	T	16: 48,958,465	M323K	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Galnt2	A	G	8: 124,343,315	I524V	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Grip1	T	C	10: 119,986,346	S405P	possibly damaging	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
L3mbtl3	T	C	10: 26,292,747	I595V	unknown	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Map1b	A	T	13: 99,433,206	D1002E	unknown	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Tbx5	C	T	5: 119,853,598	H245Y	probably damaging	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Tnr	T	C	1: 159,888,314	V882A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in Ss18l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0781:Ss18l1	UTSW	2	180055854	missense	possibly damaging	0.57
R0904:Ss18l1	UTSW	2	180059354	missense	probably damaging	1.00
R1938:Ss18l1	UTSW	2	180063345	missense	unknown
R2853:Ss18l1	UTSW	2	180058121	missense	probably damaging	1.00
R3825:Ss18l1	UTSW	2	180063310	missense	unknown
R4907:Ss18l1	UTSW	2	180063399	critical splice donor site	probably null
R5256:Ss18l1	UTSW	2	180061942	missense	unknown
R5508:Ss18l1	UTSW	2	180057653	missense	probably damaging	0.96
R6216:Ss18l1	UTSW	2	180061913	missense	unknown
R7529:Ss18l1	UTSW	2	180058157	missense	possibly damaging	0.80
R8192:Ss18l1	UTSW	2	180059362	missense	probably damaging	0.98
R8498:Ss18l1	UTSW	2	180058175	missense	probably damaging	0.96
R8830:Ss18l1	UTSW	2	180067338	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATCCGCATGGGTCACTGAATC -3'
(R):5'- CACAGACACTTAGGCTCAGAGG -3'

Sequencing Primer
(F):5'- ATGGGTCACTGAATCCTCGG -3'
(R):5'- CACTTAGGCTCAGAGGAGTACC -3'

Posted On

2018-02-27