Incidental Mutation 'R6218:Ss18l1'
ID 503825
Institutional Source Beutler Lab
Gene Symbol Ss18l1
Ensembl Gene ENSMUSG00000039086
Gene Name SS18, nBAF chromatin remodeling complex subunit like 1
Synonyms CREST, A230053O16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180042509-180070201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 180055112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 109 (V109I)
Ref Sequence ENSEMBL: ENSMUSP00000041288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041126]
AlphaFold Q8BW22
Predicted Effect probably benign
Transcript: ENSMUST00000041126
AA Change: V109I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041288
Gene: ENSMUSG00000039086
AA Change: V109I

DomainStartEndE-ValueType
Pfam:SSXT 13 74 4.3e-35 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 215 238 N/A INTRINSIC
low complexity region 244 251 N/A INTRINSIC
low complexity region 311 375 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-responsive transactivator which is an essential subunit of a neuron-specific chromatin-remodeling complex. The structure of this gene is similar to that of the SS18 gene. Mutations in this gene are involved in amyotrophic lateral sclerosis (ALS). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have central nervous system and coordination defects. They grow slowly and usually die before adulthood. Those that do survive are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Ss18l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0781:Ss18l1 UTSW 2 180055854 missense possibly damaging 0.57
R0904:Ss18l1 UTSW 2 180059354 missense probably damaging 1.00
R1938:Ss18l1 UTSW 2 180063345 missense unknown
R2853:Ss18l1 UTSW 2 180058121 missense probably damaging 1.00
R3825:Ss18l1 UTSW 2 180063310 missense unknown
R4907:Ss18l1 UTSW 2 180063399 critical splice donor site probably null
R5256:Ss18l1 UTSW 2 180061942 missense unknown
R5508:Ss18l1 UTSW 2 180057653 missense probably damaging 0.96
R6216:Ss18l1 UTSW 2 180061913 missense unknown
R7529:Ss18l1 UTSW 2 180058157 missense possibly damaging 0.80
R8192:Ss18l1 UTSW 2 180059362 missense probably damaging 0.98
R8498:Ss18l1 UTSW 2 180058175 missense probably damaging 0.96
R8830:Ss18l1 UTSW 2 180067338 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCGCATGGGTCACTGAATC -3'
(R):5'- CACAGACACTTAGGCTCAGAGG -3'

Sequencing Primer
(F):5'- ATGGGTCACTGAATCCTCGG -3'
(R):5'- CACTTAGGCTCAGAGGAGTACC -3'
Posted On 2018-02-27