Incidental Mutation 'R6218:Adam15'
ID503831
Institutional Source Beutler Lab
Gene Symbol Adam15
Ensembl Gene ENSMUSG00000028041
Gene Namea disintegrin and metallopeptidase domain 15 (metargidin)
SynonymsMDC15, metargidin
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R6218 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89338542-89349996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89343883 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 505 (I505S)
Ref Sequence ENSEMBL: ENSMUSP00000139147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029676] [ENSMUST00000074582] [ENSMUST00000107446] [ENSMUST00000107448] [ENSMUST00000184651]
Predicted Effect probably benign
Transcript: ENSMUST00000029676
AA Change: I505S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000029676
Gene: ENSMUSG00000028041
AA Change: I505S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 158 1.2e-14 PFAM
Pfam:Reprolysin_3 208 360 1e-12 PFAM
Pfam:Reprolysin_5 212 394 1.5e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 416 1.6e-54 PFAM
Pfam:Reprolysin_2 257 405 9.9e-12 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074582
AA Change: I505S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000074167
Gene: ENSMUSG00000028041
AA Change: I505S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.6e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 2.9e-8 PFAM
Pfam:Reprolysin 214 415 4.2e-56 PFAM
Pfam:Reprolysin_3 238 360 1.7e-14 PFAM
Pfam:Reprolysin_2 254 405 1.1e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 760 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107446
SMART Domains Protein: ENSMUSP00000103070
Gene: ENSMUSG00000028041

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 9.9e-22 PFAM
Pfam:Reprolysin_3 209 360 5.9e-15 PFAM
Pfam:Reprolysin_5 212 394 5e-16 PFAM
Pfam:Reprolysin_4 213 410 1e-8 PFAM
Pfam:Reprolysin 214 415 1.4e-56 PFAM
Pfam:Reprolysin_2 253 405 4e-11 PFAM
low complexity region 416 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107448
AA Change: I505S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103072
Gene: ENSMUSG00000028041
AA Change: I505S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.7e-21 PFAM
Pfam:Reprolysin_5 212 394 1.6e-15 PFAM
Pfam:Reprolysin_4 214 410 3e-8 PFAM
Pfam:Reprolysin 214 415 4.4e-56 PFAM
Pfam:Reprolysin_3 238 360 1.8e-14 PFAM
Pfam:Reprolysin_2 254 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 783 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156250
Predicted Effect probably benign
Transcript: ENSMUST00000184651
AA Change: I505S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139147
Gene: ENSMUSG00000028041
AA Change: I505S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 164 2.9e-21 PFAM
Pfam:Reprolysin_5 212 394 1.7e-15 PFAM
Pfam:Reprolysin_4 214 410 3.1e-8 PFAM
Pfam:Reprolysin 214 415 4.6e-56 PFAM
Pfam:Reprolysin_3 238 360 1.9e-14 PFAM
Pfam:Reprolysin_2 255 405 1.2e-10 PFAM
DISIN 431 507 2.28e-37 SMART
ACR 508 650 8.38e-56 SMART
EGF 657 686 7.02e-1 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 763 781 N/A INTRINSIC
low complexity region 808 862 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180791
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is prominently expressed in vascular cells, the endocardium, hypertrophic cells in developing bone, and specific areas of hippocampus and cerebellum. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein have increased bone mass resulting from osteoblast proliferation, and exhibit reduced neovascularization in a mouse model for retinopathy. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice develop normally and exhibit normal angiogenesis, but show a resistance to pathological neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Adam15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Adam15 APN 3 89344138 missense probably benign 0.03
IGL01994:Adam15 APN 3 89341505 splice site probably benign
IGL02184:Adam15 APN 3 89345934 splice site probably benign
IGL02501:Adam15 APN 3 89340462 missense possibly damaging 0.82
IGL02821:Adam15 APN 3 89345356 missense probably damaging 1.00
IGL02933:Adam15 APN 3 89343483 missense possibly damaging 0.91
IGL03078:Adam15 APN 3 89345937 splice site probably benign
IGL03185:Adam15 APN 3 89347905 missense probably benign 0.41
PIT4280001:Adam15 UTSW 3 89343978 critical splice acceptor site probably null
PIT4581001:Adam15 UTSW 3 89343832 missense probably benign 0.00
R0559:Adam15 UTSW 3 89343778 missense probably damaging 1.00
R1530:Adam15 UTSW 3 89349830 missense probably damaging 0.99
R1670:Adam15 UTSW 3 89348510 splice site probably benign
R1909:Adam15 UTSW 3 89345330 missense probably benign 0.19
R3110:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3112:Adam15 UTSW 3 89347457 missense probably benign 0.10
R3897:Adam15 UTSW 3 89346938 missense probably benign 0.00
R4058:Adam15 UTSW 3 89347055 missense possibly damaging 0.94
R4573:Adam15 UTSW 3 89345986 missense probably damaging 1.00
R5267:Adam15 UTSW 3 89349899 utr 5 prime probably benign
R5364:Adam15 UTSW 3 89345595 missense probably damaging 1.00
R5801:Adam15 UTSW 3 89342361 missense probably damaging 1.00
R5813:Adam15 UTSW 3 89345828 missense probably benign 0.12
R5964:Adam15 UTSW 3 89343567 nonsense probably null
R6564:Adam15 UTSW 3 89347212 missense possibly damaging 0.56
R6579:Adam15 UTSW 3 89345629 missense probably damaging 1.00
R6834:Adam15 UTSW 3 89340083 missense probably damaging 0.96
R7131:Adam15 UTSW 3 89346980 missense possibly damaging 0.64
R7204:Adam15 UTSW 3 89346937 missense probably benign 0.01
R7578:Adam15 UTSW 3 89344192 missense probably damaging 1.00
R7663:Adam15 UTSW 3 89345806 missense probably damaging 0.99
R8016:Adam15 UTSW 3 89345361 missense probably benign
R8098:Adam15 UTSW 3 89343886 missense probably damaging 1.00
R8133:Adam15 UTSW 3 89347206 missense probably benign 0.02
R8230:Adam15 UTSW 3 89345610 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGGTGCCCACAAACTCAGG -3'
(R):5'- CAGGCTCAAAGACTCATCCTG -3'

Sequencing Primer
(F):5'- CACTTACCTAGGGGCACAAGG -3'
(R):5'- ATCCTGAGCTCTGACCCTGAG -3'
Posted On2018-02-27