Incidental Mutation 'R6218:Cald1'
ID503836
Institutional Source Beutler Lab
Gene Symbol Cald1
Ensembl Gene ENSMUSG00000029761
Gene Namecaldesmon 1
Synonyms4833423D12Rik, C920027I18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6218 (G1)
Quality Score159.468
Status Validated
Chromosome6
Chromosomal Location34598500-34775473 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAAA to CAAA at 34747928 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031775] [ENSMUST00000079391] [ENSMUST00000115021] [ENSMUST00000115026] [ENSMUST00000115027] [ENSMUST00000126181] [ENSMUST00000142512] [ENSMUST00000149009]
AlphaFold E9QA15
Predicted Effect probably null
Transcript: ENSMUST00000031775
SMART Domains Protein: ENSMUSP00000031775
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 542 5.7e-256 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079391
SMART Domains Protein: ENSMUSP00000078362
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 522 4.3e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115021
SMART Domains Protein: ENSMUSP00000110673
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 518 7.5e-259 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115026
SMART Domains Protein: ENSMUSP00000110678
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 524 4.9e-259 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115027
SMART Domains Protein: ENSMUSP00000110679
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 363 8.4e-34 PFAM
Pfam:Caldesmon 243 755 3.8e-144 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123823
SMART Domains Protein: ENSMUSP00000117064
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 210 4e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126181
SMART Domains Protein: ENSMUSP00000121911
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 138 7.6e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136907
SMART Domains Protein: ENSMUSP00000121213
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 50 354 4.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142512
SMART Domains Protein: ENSMUSP00000122926
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Caldesmon 31 253 9.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142716
SMART Domains Protein: ENSMUSP00000116247
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 1 274 2.7e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146685
Predicted Effect probably benign
Transcript: ENSMUST00000149009
SMART Domains Protein: ENSMUSP00000138368
Gene: ENSMUSG00000029761

DomainStartEndE-ValueType
Pfam:Caldesmon 25 507 2e-247 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Some homozygous mutant mice develop hernia and those that do, die within 5-7 hours after birth. Mice homozygous for a different targeted allele fail to develop. Mice heterozygous for this allele exhibit increased urinary bladder weight, smooth muscle bundles and non-voiding contractions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Cald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Cald1 APN 6 34762261 missense possibly damaging 0.66
IGL01456:Cald1 APN 6 34764996 missense probably damaging 1.00
IGL01822:Cald1 APN 6 34753572 missense probably damaging 0.99
IGL01959:Cald1 APN 6 34753468 missense probably damaging 1.00
IGL02307:Cald1 APN 6 34753455 missense probably damaging 1.00
IGL03122:Cald1 APN 6 34765028 missense probably damaging 1.00
R0060:Cald1 UTSW 6 34715459 intron probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0071:Cald1 UTSW 6 34758134 splice site probably benign
R0701:Cald1 UTSW 6 34746173 frame shift probably null
R0776:Cald1 UTSW 6 34746173 frame shift probably null
R1053:Cald1 UTSW 6 34755642 missense probably damaging 1.00
R1696:Cald1 UTSW 6 34745711 missense probably damaging 1.00
R2025:Cald1 UTSW 6 34746173 frame shift probably null
R2157:Cald1 UTSW 6 34686041 missense possibly damaging 0.86
R2973:Cald1 UTSW 6 34757996 unclassified probably benign
R3839:Cald1 UTSW 6 34745765 missense probably damaging 1.00
R4116:Cald1 UTSW 6 34745719 missense probably damaging 1.00
R4674:Cald1 UTSW 6 34746173 frame shift probably null
R5140:Cald1 UTSW 6 34753580 missense probably damaging 1.00
R5254:Cald1 UTSW 6 34746416 intron probably benign
R5620:Cald1 UTSW 6 34762112 missense probably damaging 1.00
R5648:Cald1 UTSW 6 34762332 splice site probably null
R5651:Cald1 UTSW 6 34762320 missense probably damaging 0.98
R5783:Cald1 UTSW 6 34753533 missense possibly damaging 0.51
R5872:Cald1 UTSW 6 34771108 nonsense probably null
R5999:Cald1 UTSW 6 34746338 intron probably benign
R6347:Cald1 UTSW 6 34765046 missense probably damaging 1.00
R6598:Cald1 UTSW 6 34746640 critical splice donor site probably null
R7120:Cald1 UTSW 6 34686076 critical splice donor site probably null
R7147:Cald1 UTSW 6 34746296 missense
R7385:Cald1 UTSW 6 34686065 missense probably damaging 0.99
R7516:Cald1 UTSW 6 34709557 start gained probably benign
R7841:Cald1 UTSW 6 34745761 missense unknown
R8732:Cald1 UTSW 6 34758011 missense unknown
R9151:Cald1 UTSW 6 34755747 missense not run
X0064:Cald1 UTSW 6 34746205 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCTGATGACAAGCCACTAGC -3'
(R):5'- TGGAGGCACCTATACAATCTCATCAG -3'

Sequencing Primer
(F):5'- ACTAGCACCAGGTACCACTG -3'
(R):5'- GTGACTCATGAGCCACAGTCTG -3'
Posted On2018-02-27