Incidental Mutation 'R6218:Iqsec1'
ID 503837
Institutional Source Beutler Lab
Gene Symbol Iqsec1
Ensembl Gene ENSMUSG00000034312
Gene Name IQ motif and Sec7 domain 1
Synonyms D6Ertd349e, cI-43, BRAG2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 90656088-90988685 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90689635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 607 (S607C)
Ref Sequence ENSEMBL: ENSMUSP00000148669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101151] [ENSMUST00000101153] [ENSMUST00000156834] [ENSMUST00000212100]
AlphaFold Q8R0S2
Predicted Effect probably damaging
Transcript: ENSMUST00000101151
AA Change: S503C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098710
Gene: ENSMUSG00000034312
AA Change: S503C

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Blast:Sec7 69 369 6e-39 BLAST
low complexity region 370 389 N/A INTRINSIC
low complexity region 396 430 N/A INTRINSIC
low complexity region 450 481 N/A INTRINSIC
Sec7 505 696 1.31e-95 SMART
PH 737 848 2.39e-2 SMART
low complexity region 901 914 N/A INTRINSIC
low complexity region 963 976 N/A INTRINSIC
low complexity region 978 1000 N/A INTRINSIC
low complexity region 1014 1060 N/A INTRINSIC
low complexity region 1062 1094 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101153
AA Change: S517C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098712
Gene: ENSMUSG00000034312
AA Change: S517C

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:Sec7 83 383 4e-39 BLAST
low complexity region 384 403 N/A INTRINSIC
low complexity region 410 444 N/A INTRINSIC
low complexity region 464 495 N/A INTRINSIC
Sec7 519 710 1.31e-95 SMART
PH 751 862 2.39e-2 SMART
low complexity region 915 928 N/A INTRINSIC
low complexity region 948 957 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146977
Predicted Effect probably benign
Transcript: ENSMUST00000156834
SMART Domains Protein: ENSMUSP00000118802
Gene: ENSMUSG00000034312

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
Blast:Sec7 84 208 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205068
Predicted Effect probably damaging
Transcript: ENSMUST00000212100
AA Change: S607C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2832 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in neurons fail to exhibit mGluR- and NMDAR-mediated long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Iqsec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Iqsec1 APN 6 90689703 missense probably damaging 1.00
IGL01749:Iqsec1 APN 6 90680504 missense probably benign 0.03
IGL01960:Iqsec1 APN 6 90676780 missense probably damaging 1.00
IGL02007:Iqsec1 APN 6 90690349 missense probably benign 0.37
IGL02045:Iqsec1 APN 6 90664069 missense probably damaging 0.96
IGL02186:Iqsec1 APN 6 90676877 missense probably damaging 1.00
IGL02211:Iqsec1 APN 6 90671609 missense probably damaging 1.00
IGL02503:Iqsec1 APN 6 90668788 missense probably damaging 1.00
IGL02506:Iqsec1 APN 6 90672075 missense possibly damaging 0.94
IGL02554:Iqsec1 APN 6 90669345 missense probably damaging 1.00
PIT4260001:Iqsec1 UTSW 6 90690489 missense probably damaging 1.00
PIT4810001:Iqsec1 UTSW 6 90670491 missense probably damaging 1.00
R0139:Iqsec1 UTSW 6 90809758 intron probably benign
R0371:Iqsec1 UTSW 6 90670403 splice site probably benign
R0617:Iqsec1 UTSW 6 90689970 missense probably damaging 1.00
R0619:Iqsec1 UTSW 6 90670406 splice site probably null
R1157:Iqsec1 UTSW 6 90669384 missense possibly damaging 0.83
R1168:Iqsec1 UTSW 6 90689676 missense probably damaging 1.00
R1190:Iqsec1 UTSW 6 90689677 missense probably damaging 1.00
R1192:Iqsec1 UTSW 6 90671976 splice site probably benign
R1435:Iqsec1 UTSW 6 90672024 missense probably damaging 1.00
R1449:Iqsec1 UTSW 6 90690808 nonsense probably null
R1697:Iqsec1 UTSW 6 90809770 nonsense probably null
R1921:Iqsec1 UTSW 6 90662895 missense probably benign 0.00
R1958:Iqsec1 UTSW 6 90670459 missense probably damaging 1.00
R2017:Iqsec1 UTSW 6 90689930 missense probably benign 0.02
R2082:Iqsec1 UTSW 6 90694574 missense probably damaging 1.00
R2372:Iqsec1 UTSW 6 90694654 missense probably damaging 1.00
R2442:Iqsec1 UTSW 6 90689883 missense possibly damaging 0.52
R4120:Iqsec1 UTSW 6 90662602 nonsense probably null
R4371:Iqsec1 UTSW 6 90694606 missense probably damaging 1.00
R4645:Iqsec1 UTSW 6 90668013 missense probably damaging 1.00
R4864:Iqsec1 UTSW 6 90664056 missense probably damaging 1.00
R5436:Iqsec1 UTSW 6 90845361 intron probably benign
R5790:Iqsec1 UTSW 6 90689880 nonsense probably null
R6007:Iqsec1 UTSW 6 90660987 nonsense probably null
R6143:Iqsec1 UTSW 6 90809684 splice site probably null
R6972:Iqsec1 UTSW 6 90676768 missense probably damaging 1.00
R7506:Iqsec1 UTSW 6 90662806 missense possibly damaging 0.53
R7506:Iqsec1 UTSW 6 90667909 missense probably damaging 1.00
R7539:Iqsec1 UTSW 6 90662891 missense probably benign 0.00
R7921:Iqsec1 UTSW 6 90667941 missense probably damaging 1.00
R7946:Iqsec1 UTSW 6 90690270 missense probably damaging 1.00
R8238:Iqsec1 UTSW 6 90689930 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGGTAGAGGCTCACAGTAG -3'
(R):5'- AGAGTCACCTAGCCATCAATG -3'

Sequencing Primer
(F):5'- CTCACAGTAGGAGGGAAGATGGATTC -3'
(R):5'- GAGCAAATCTGAGTCTGACTACTC -3'
Posted On 2018-02-27