Incidental Mutation 'R6218:Dnaaf3'
ID 503840
Institutional Source Beutler Lab
Gene Symbol Dnaaf3
Ensembl Gene ENSMUSG00000055809
Gene Name dynein, axonemal assembly factor 3
Synonyms 6030429G01Rik, b2b1739Clo
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.483) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 4525932-4535452 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4526671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 469 (S469T)
Ref Sequence ENSEMBL: ENSMUSP00000092498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094897] [ENSMUST00000098859] [ENSMUST00000140424] [ENSMUST00000154913] [ENSMUST00000209148]
AlphaFold Q3UYV8
Predicted Effect probably benign
Transcript: ENSMUST00000094897
AA Change: S469T

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092498
Gene: ENSMUSG00000055809
AA Change: S469T

DomainStartEndE-ValueType
Pfam:DUF4470 16 122 1.3e-27 PFAM
Pfam:DUF4471 154 436 5.3e-104 PFAM
internal_repeat_1 467 512 1.63e-5 PROSPERO
internal_repeat_1 525 568 1.63e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000098859
SMART Domains Protein: ENSMUSP00000096458
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1e-10 PFAM
Pfam:Troponin 47 178 3.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132621
Predicted Effect probably benign
Transcript: ENSMUST00000140424
SMART Domains Protein: ENSMUSP00000115015
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 1.1e-14 PFAM
Pfam:Troponin 47 125 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150166
Predicted Effect probably benign
Transcript: ENSMUST00000154913
SMART Domains Protein: ENSMUSP00000122916
Gene: ENSMUSG00000035458

DomainStartEndE-ValueType
Pfam:Troponin-I_N 1 32 9e-15 PFAM
Pfam:Troponin 47 112 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205662
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the assembly of axonemal inner and outer dynein arms and plays a role in assembling dynein complexes for transport into cilia. Defects in this gene are a cause of primary ciliary dyskinesia type 2 (CILD2). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit situs inversus totalis and complex congenital heart disease associated with heterotaxy, abdominal organ situs anomalies and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,728,730 (GRCm39) Q38K probably benign Het
9930111J21Rik2 A T 11: 48,910,134 (GRCm39) N766K probably benign Het
Adam15 A C 3: 89,251,190 (GRCm39) I505S probably benign Het
Apc2 T C 10: 80,142,254 (GRCm39) M391T probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bclaf1 A G 10: 20,210,374 (GRCm39) S840G probably benign Het
Cacna2d4 A G 6: 119,216,021 (GRCm39) Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,724,863 (GRCm39) probably null Het
Ddhd1 A G 14: 45,851,633 (GRCm39) L141P probably damaging Het
Dzip3 A T 16: 48,778,828 (GRCm39) M323K possibly damaging Het
Eci2 T A 13: 35,177,048 (GRCm39) probably null Het
Fam227b A T 2: 125,968,882 (GRCm39) V64E probably damaging Het
Galnt2 A G 8: 125,070,054 (GRCm39) I524V probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm3443 T A 19: 21,533,110 (GRCm39) S25T probably damaging Het
Gpr22 T A 12: 31,761,616 (GRCm39) K14* probably null Het
Grip1 T C 10: 119,822,251 (GRCm39) S405P possibly damaging Het
Helz2 T C 2: 180,877,738 (GRCm39) H1020R probably damaging Het
Helz2 C A 2: 180,874,087 (GRCm39) V2136L probably benign Het
Il36rn G A 2: 24,167,502 (GRCm39) probably benign Het
Iqsec1 T A 6: 90,666,617 (GRCm39) S607C probably damaging Het
Irag1 G A 7: 110,476,112 (GRCm39) T819M probably benign Het
Klhl2 A T 8: 65,205,801 (GRCm39) Y373* probably null Het
L3mbtl3 T C 10: 26,168,645 (GRCm39) I595V unknown Het
Large2 T C 2: 92,200,981 (GRCm39) D65G probably damaging Het
Lrrfip1 T C 1: 91,009,881 (GRCm39) Y122H probably damaging Het
Map1b A T 13: 99,569,714 (GRCm39) D1002E unknown Het
Mink1 C T 11: 70,489,720 (GRCm39) T59I possibly damaging Het
Myo7b T C 18: 32,092,507 (GRCm39) N2097D probably benign Het
Nbea C A 3: 55,535,905 (GRCm39) C2893F probably damaging Het
Nlgn1 A T 3: 25,490,257 (GRCm39) V490E probably damaging Het
Or2w1b G A 13: 21,300,401 (GRCm39) E180K probably damaging Het
Or2y3 A G 17: 38,393,620 (GRCm39) M83T probably damaging Het
Or4c123 G T 2: 89,127,306 (GRCm39) H103N probably damaging Het
Or4f62 T C 2: 111,986,701 (GRCm39) I135T probably damaging Het
Or4k2 C A 14: 50,424,135 (GRCm39) D180Y probably damaging Het
Pctp A G 11: 89,878,144 (GRCm39) I130T probably benign Het
Pdcl3 T C 1: 39,027,152 (GRCm39) probably null Het
Pheta2 T A 15: 82,227,917 (GRCm39) H145Q probably benign Het
Pira12 A T 7: 3,897,031 (GRCm39) S602T possibly damaging Het
Pkp1 T C 1: 135,807,646 (GRCm39) K541E probably damaging Het
Plekhh2 G A 17: 84,898,992 (GRCm39) V990I probably benign Het
Ppp1r3a A T 6: 14,718,430 (GRCm39) V828D probably damaging Het
Prrc2b T C 2: 32,098,823 (GRCm39) Y712H probably damaging Het
Prune2 T C 19: 17,098,926 (GRCm39) S1477P probably benign Het
Psma5 A G 3: 108,187,118 (GRCm39) K239R probably benign Het
Rhobtb1 G C 10: 69,106,286 (GRCm39) A284P probably benign Het
Samsn1 G A 16: 75,742,162 (GRCm39) noncoding transcript Het
Scel A G 14: 103,809,478 (GRCm39) T273A probably benign Het
Slc22a5 T A 11: 53,782,444 (GRCm39) probably benign Het
Slc25a37 A T 14: 69,486,953 (GRCm39) M110K possibly damaging Het
Slc6a2 A T 8: 93,708,609 (GRCm39) M242L probably benign Het
Slc8a3 C A 12: 81,246,341 (GRCm39) W904L probably benign Het
Ss18l1 G A 2: 179,696,905 (GRCm39) V109I probably benign Het
Tbx5 C T 5: 119,991,663 (GRCm39) H245Y probably damaging Het
Thumpd2 C A 17: 81,360,342 (GRCm39) L244F probably damaging Het
Tmem107 T A 11: 68,962,241 (GRCm39) V66E probably damaging Het
Tnr T C 1: 159,715,884 (GRCm39) V882A possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttbk1 A G 17: 46,781,733 (GRCm39) V340A possibly damaging Het
Veph1 T C 3: 66,162,481 (GRCm39) E59G probably damaging Het
Vmn1r234 T A 17: 21,449,983 (GRCm39) M299K possibly damaging Het
Vps13b T C 15: 35,770,610 (GRCm39) Y2018H probably benign Het
Zbtb11 A G 16: 55,818,436 (GRCm39) E620G probably benign Het
Zfp418 A G 7: 7,185,627 (GRCm39) H530R possibly damaging Het
Zfp764l1 C T 7: 126,992,581 (GRCm39) A10T possibly damaging Het
Other mutations in Dnaaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02197:Dnaaf3 APN 7 4,530,496 (GRCm39) missense probably damaging 1.00
IGL02319:Dnaaf3 APN 7 4,526,946 (GRCm39) missense probably damaging 1.00
IGL02805:Dnaaf3 APN 7 4,526,704 (GRCm39) missense possibly damaging 0.64
R1818:Dnaaf3 UTSW 7 4,526,569 (GRCm39) missense probably benign 0.35
R1818:Dnaaf3 UTSW 7 4,526,568 (GRCm39) splice site probably null
R2063:Dnaaf3 UTSW 7 4,526,798 (GRCm39) missense possibly damaging 0.87
R2064:Dnaaf3 UTSW 7 4,526,798 (GRCm39) missense possibly damaging 0.87
R2066:Dnaaf3 UTSW 7 4,526,798 (GRCm39) missense possibly damaging 0.87
R2068:Dnaaf3 UTSW 7 4,526,798 (GRCm39) missense possibly damaging 0.87
R2132:Dnaaf3 UTSW 7 4,526,800 (GRCm39) missense probably benign 0.00
R2363:Dnaaf3 UTSW 7 4,535,276 (GRCm39) critical splice acceptor site probably null
R4710:Dnaaf3 UTSW 7 4,529,493 (GRCm39) missense probably damaging 1.00
R4803:Dnaaf3 UTSW 7 4,529,903 (GRCm39) missense probably benign 0.14
R4939:Dnaaf3 UTSW 7 4,530,144 (GRCm39) missense probably damaging 1.00
R5487:Dnaaf3 UTSW 7 4,526,864 (GRCm39) splice site probably null
R5846:Dnaaf3 UTSW 7 4,526,686 (GRCm39) missense possibly damaging 0.73
R6084:Dnaaf3 UTSW 7 4,527,212 (GRCm39) missense probably benign 0.00
R6576:Dnaaf3 UTSW 7 4,526,379 (GRCm39) missense probably benign 0.41
R6916:Dnaaf3 UTSW 7 4,530,532 (GRCm39) missense probably damaging 1.00
R7219:Dnaaf3 UTSW 7 4,531,076 (GRCm39) missense probably damaging 1.00
R8399:Dnaaf3 UTSW 7 4,526,936 (GRCm39) critical splice donor site probably null
R8678:Dnaaf3 UTSW 7 4,533,814 (GRCm39) missense probably damaging 1.00
R9515:Dnaaf3 UTSW 7 4,531,100 (GRCm39) missense probably damaging 1.00
Z1088:Dnaaf3 UTSW 7 4,526,794 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAGGCAGGACTAGCTTAGC -3'
(R):5'- CCAAGGAGTTGAAGGCGTTC -3'

Sequencing Primer
(F):5'- CAGCTTTGGATGGGCTCAAC -3'
(R):5'- CTCTGACCGCGTTGTAGAGATAGC -3'
Posted On 2018-02-27