Incidental Mutation 'R6218:Zfp764l1'
ID 503843
Institutional Source Beutler Lab
Gene Symbol Zfp764l1
Ensembl Gene ENSMUSG00000078580
Gene Name zinc finger protein 764 like 1
Synonyms E430018J23Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 126988845-126992801 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 126992581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 10 (A10T)
Ref Sequence ENSEMBL: ENSMUSP00000101910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074249] [ENSMUST00000106303] [ENSMUST00000165495]
AlphaFold E9PZQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000074249
AA Change: A10T

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073867
Gene: ENSMUSG00000078580
AA Change: A10T

DomainStartEndE-ValueType
KRAB 22 79 4.43e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106303
AA Change: A10T

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101910
Gene: ENSMUSG00000078580
AA Change: A10T

DomainStartEndE-ValueType
KRAB 22 81 9.25e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122370
Predicted Effect possibly damaging
Transcript: ENSMUST00000165495
AA Change: A10T

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580
AA Change: A10T

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,728,730 (GRCm39) Q38K probably benign Het
9930111J21Rik2 A T 11: 48,910,134 (GRCm39) N766K probably benign Het
Adam15 A C 3: 89,251,190 (GRCm39) I505S probably benign Het
Apc2 T C 10: 80,142,254 (GRCm39) M391T probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bclaf1 A G 10: 20,210,374 (GRCm39) S840G probably benign Het
Cacna2d4 A G 6: 119,216,021 (GRCm39) Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,724,863 (GRCm39) probably null Het
Ddhd1 A G 14: 45,851,633 (GRCm39) L141P probably damaging Het
Dnaaf3 A T 7: 4,526,671 (GRCm39) S469T probably benign Het
Dzip3 A T 16: 48,778,828 (GRCm39) M323K possibly damaging Het
Eci2 T A 13: 35,177,048 (GRCm39) probably null Het
Fam227b A T 2: 125,968,882 (GRCm39) V64E probably damaging Het
Galnt2 A G 8: 125,070,054 (GRCm39) I524V probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm3443 T A 19: 21,533,110 (GRCm39) S25T probably damaging Het
Gpr22 T A 12: 31,761,616 (GRCm39) K14* probably null Het
Grip1 T C 10: 119,822,251 (GRCm39) S405P possibly damaging Het
Helz2 T C 2: 180,877,738 (GRCm39) H1020R probably damaging Het
Helz2 C A 2: 180,874,087 (GRCm39) V2136L probably benign Het
Il36rn G A 2: 24,167,502 (GRCm39) probably benign Het
Iqsec1 T A 6: 90,666,617 (GRCm39) S607C probably damaging Het
Irag1 G A 7: 110,476,112 (GRCm39) T819M probably benign Het
Klhl2 A T 8: 65,205,801 (GRCm39) Y373* probably null Het
L3mbtl3 T C 10: 26,168,645 (GRCm39) I595V unknown Het
Large2 T C 2: 92,200,981 (GRCm39) D65G probably damaging Het
Lrrfip1 T C 1: 91,009,881 (GRCm39) Y122H probably damaging Het
Map1b A T 13: 99,569,714 (GRCm39) D1002E unknown Het
Mink1 C T 11: 70,489,720 (GRCm39) T59I possibly damaging Het
Myo7b T C 18: 32,092,507 (GRCm39) N2097D probably benign Het
Nbea C A 3: 55,535,905 (GRCm39) C2893F probably damaging Het
Nlgn1 A T 3: 25,490,257 (GRCm39) V490E probably damaging Het
Or2w1b G A 13: 21,300,401 (GRCm39) E180K probably damaging Het
Or2y3 A G 17: 38,393,620 (GRCm39) M83T probably damaging Het
Or4c123 G T 2: 89,127,306 (GRCm39) H103N probably damaging Het
Or4f62 T C 2: 111,986,701 (GRCm39) I135T probably damaging Het
Or4k2 C A 14: 50,424,135 (GRCm39) D180Y probably damaging Het
Pctp A G 11: 89,878,144 (GRCm39) I130T probably benign Het
Pdcl3 T C 1: 39,027,152 (GRCm39) probably null Het
Pheta2 T A 15: 82,227,917 (GRCm39) H145Q probably benign Het
Pira12 A T 7: 3,897,031 (GRCm39) S602T possibly damaging Het
Pkp1 T C 1: 135,807,646 (GRCm39) K541E probably damaging Het
Plekhh2 G A 17: 84,898,992 (GRCm39) V990I probably benign Het
Ppp1r3a A T 6: 14,718,430 (GRCm39) V828D probably damaging Het
Prrc2b T C 2: 32,098,823 (GRCm39) Y712H probably damaging Het
Prune2 T C 19: 17,098,926 (GRCm39) S1477P probably benign Het
Psma5 A G 3: 108,187,118 (GRCm39) K239R probably benign Het
Rhobtb1 G C 10: 69,106,286 (GRCm39) A284P probably benign Het
Samsn1 G A 16: 75,742,162 (GRCm39) noncoding transcript Het
Scel A G 14: 103,809,478 (GRCm39) T273A probably benign Het
Slc22a5 T A 11: 53,782,444 (GRCm39) probably benign Het
Slc25a37 A T 14: 69,486,953 (GRCm39) M110K possibly damaging Het
Slc6a2 A T 8: 93,708,609 (GRCm39) M242L probably benign Het
Slc8a3 C A 12: 81,246,341 (GRCm39) W904L probably benign Het
Ss18l1 G A 2: 179,696,905 (GRCm39) V109I probably benign Het
Tbx5 C T 5: 119,991,663 (GRCm39) H245Y probably damaging Het
Thumpd2 C A 17: 81,360,342 (GRCm39) L244F probably damaging Het
Tmem107 T A 11: 68,962,241 (GRCm39) V66E probably damaging Het
Tnr T C 1: 159,715,884 (GRCm39) V882A possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttbk1 A G 17: 46,781,733 (GRCm39) V340A possibly damaging Het
Veph1 T C 3: 66,162,481 (GRCm39) E59G probably damaging Het
Vmn1r234 T A 17: 21,449,983 (GRCm39) M299K possibly damaging Het
Vps13b T C 15: 35,770,610 (GRCm39) Y2018H probably benign Het
Zbtb11 A G 16: 55,818,436 (GRCm39) E620G probably benign Het
Zfp418 A G 7: 7,185,627 (GRCm39) H530R possibly damaging Het
Other mutations in Zfp764l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Zfp764l1 APN 7 126,991,208 (GRCm39) missense possibly damaging 0.92
IGL01782:Zfp764l1 APN 7 126,992,476 (GRCm39) missense probably benign 0.02
IGL02174:Zfp764l1 APN 7 126,991,525 (GRCm39) missense possibly damaging 0.54
IGL02882:Zfp764l1 APN 7 126,991,424 (GRCm39) missense probably damaging 1.00
IGL03152:Zfp764l1 APN 7 126,991,469 (GRCm39) missense probably damaging 1.00
R0552:Zfp764l1 UTSW 7 126,991,504 (GRCm39) missense possibly damaging 0.92
R1828:Zfp764l1 UTSW 7 126,991,081 (GRCm39) missense probably damaging 1.00
R1843:Zfp764l1 UTSW 7 126,990,660 (GRCm39) missense probably benign 0.32
R1866:Zfp764l1 UTSW 7 126,992,503 (GRCm39) missense probably damaging 1.00
R3429:Zfp764l1 UTSW 7 126,990,914 (GRCm39) missense possibly damaging 0.79
R4433:Zfp764l1 UTSW 7 126,992,174 (GRCm39) missense possibly damaging 0.75
R4933:Zfp764l1 UTSW 7 126,992,521 (GRCm39) missense probably damaging 1.00
R5292:Zfp764l1 UTSW 7 126,991,659 (GRCm39) missense possibly damaging 0.48
R6667:Zfp764l1 UTSW 7 126,992,595 (GRCm39) missense probably benign 0.35
R6712:Zfp764l1 UTSW 7 126,991,482 (GRCm39) missense probably damaging 1.00
R7108:Zfp764l1 UTSW 7 126,990,695 (GRCm39) missense probably benign 0.05
R7214:Zfp764l1 UTSW 7 126,990,695 (GRCm39) missense probably benign 0.05
R7215:Zfp764l1 UTSW 7 126,990,695 (GRCm39) missense probably benign 0.05
R7216:Zfp764l1 UTSW 7 126,990,695 (GRCm39) missense probably benign 0.05
R7313:Zfp764l1 UTSW 7 126,990,856 (GRCm39) missense probably benign 0.23
R7396:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7397:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7398:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7478:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7479:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7480:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7481:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7512:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7652:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7716:Zfp764l1 UTSW 7 126,991,259 (GRCm39) missense probably benign
R7820:Zfp764l1 UTSW 7 126,990,608 (GRCm39) missense possibly damaging 0.84
R7923:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R7999:Zfp764l1 UTSW 7 126,991,600 (GRCm39) missense probably damaging 0.98
R8097:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8098:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8100:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8182:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8184:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8185:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8309:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8389:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8433:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R8436:Zfp764l1 UTSW 7 126,992,496 (GRCm39) missense probably null 0.88
R9196:Zfp764l1 UTSW 7 126,990,761 (GRCm39) missense probably benign 0.02
R9779:Zfp764l1 UTSW 7 126,991,469 (GRCm39) missense probably damaging 1.00
X0022:Zfp764l1 UTSW 7 126,992,442 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACCCACAGTGTCAAGGG -3'
(R):5'- GCATCTGTACCTGCTTCTAGGAATC -3'

Sequencing Primer
(F):5'- ACAGTGTCAAGGGCTACGC -3'
(R):5'- GCTTCTAGGAATCTTCAATTTTCACC -3'
Posted On 2018-02-27