Mutagenetix > Incidental Mutations

Incidental Mutation 'R6218:Galnt2'

503846

Institutional Source

Beutler Lab

Gene Symbol

Galnt2

Ensembl Gene

ENSMUSG00000089704

Gene Name

polypeptide N-acetylgalactosaminyltransferase 2

Synonyms

ppGaNTase-T2

Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R6218 (G1)

Quality Score

220.009

Status

Validated

Chromosome

Chromosomal Location

124231391-124345724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124343315 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 524 (I524V)

Ref Sequence

ENSEMBL: ENSMUSP00000034458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]

Predicted Effect

probably benign
Transcript: ENSMUST00000034458
AA Change: I524V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: I524V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	25	39	N/A	INTRINSIC
Pfam:Glycos_transf_2	138	321	8.3e-31	PFAM
Pfam:Glyco_transf_7C	295	365	5.4e-8	PFAM
RICIN	440	565	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127664
AA Change: I490V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: I490V

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147911

Meta Mutation Damage Score

0.0829

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Allele List at MGI

None

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
Dzip3	A	T	16: 48,958,465	M323K	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Grip1	T	C	10: 119,986,346	S405P	possibly damaging	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
L3mbtl3	T	C	10: 26,292,747	I595V	unknown	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Map1b	A	T	13: 99,433,206	D1002E	unknown	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Ss18l1	G	A	2: 180,055,112	V109I	probably benign	Het
Tbx5	C	T	5: 119,853,598	H245Y	probably damaging	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Tnr	T	C	1: 159,888,314	V882A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in Galnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02187:Galnt2	APN	8	124305506	splice site	probably benign
IGL02638:Galnt2	APN	8	124231579	missense	probably damaging	0.98
chivalry	UTSW	8	124334286	nonsense	probably null
gallantry	UTSW	8	124340822	missense	probably damaging	1.00
valor	UTSW	8	124329788	missense	probably damaging	1.00
P0018:Galnt2	UTSW	8	124336611	missense	probably damaging	1.00
R0133:Galnt2	UTSW	8	124338538	missense	probably benign	0.19
R0453:Galnt2	UTSW	8	124338584	splice site	probably benign
R0709:Galnt2	UTSW	8	124343346	missense	probably benign	0.01
R1015:Galnt2	UTSW	8	124336617	missense	probably benign
R4388:Galnt2	UTSW	8	124295453	critical splice donor site	probably null
R4400:Galnt2	UTSW	8	124324303	missense	probably damaging	1.00
R4447:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4448:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4449:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4450:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4927:Galnt2	UTSW	8	124305623	missense	probably damaging	1.00
R5536:Galnt2	UTSW	8	124323673	missense	probably damaging	1.00
R6732:Galnt2	UTSW	8	124340822	missense	probably damaging	1.00
R6795:Galnt2	UTSW	8	124343436	missense	probably damaging	1.00
R6823:Galnt2	UTSW	8	124324011	missense	probably benign
R7173:Galnt2	UTSW	8	124305553	missense	probably benign	0.00
R7479:Galnt2	UTSW	8	124334338	missense	probably damaging	1.00
R7818:Galnt2	UTSW	8	124329788	missense	probably damaging	1.00
R7821:Galnt2	UTSW	8	124343395	missense	possibly damaging	0.51
R7831:Galnt2	UTSW	8	124332078	missense	probably benign	0.04
R8348:Galnt2	UTSW	8	124334286	nonsense	probably null
R8770:Galnt2	UTSW	8	124334286	nonsense	probably null
R8826:Galnt2	UTSW	8	124305608	missense	probably damaging	1.00
X0024:Galnt2	UTSW	8	124343345	missense	probably benign	0.28
Z1177:Galnt2	UTSW	8	124343318	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- CCAAGAGTGACACGTGAAGC -3'
(R):5'- TACGTGATCAACAAACTGGGC -3'

Sequencing Primer
(F):5'- CACGTGAAGCATGGGGC -3'
(R):5'- TCAACAAACTGGGCCGGTG -3'

Posted On

2018-02-27