Mutagenetix > Incidental Mutation

Incidental Mutation 'R6218:L3mbtl3'

503848

Institutional Source

Beutler Lab

Gene Symbol

L3mbtl3

Ensembl Gene

ENSMUSG00000039089

Gene Name

L3MBTL3 histone methyl-lysine binding protein

Synonyms

MBT-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26274468-26375971 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26292747 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 595 (I595V)

Ref Sequence

ENSEMBL: ENSMUSP00000133479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]

AlphaFold

Q8BLB7

Predicted Effect

unknown
Transcript: ENSMUST00000040219
AA Change: I595V

SMART Domains

Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089
AA Change: I595V

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000105519
AA Change: I570V

SMART Domains

Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089
AA Change: I570V

Domain	Start	End	E-Value	Type
low complexity region	129	141	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
MBT	207	307	3.75e-48	SMART
MBT	315	414	3.67e-42	SMART
MBT	423	518	7.5e-48	SMART
low complexity region	579	590	N/A	INTRINSIC
low complexity region	637	745	N/A	INTRINSIC
SAM	783	850	2.49e-13	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000174766
AA Change: I595V

SMART Domains

Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089
AA Change: I595V

Domain	Start	End	E-Value	Type
low complexity region	154	166	N/A	INTRINSIC
low complexity region	204	214	N/A	INTRINSIC
MBT	232	332	3.75e-48	SMART
MBT	340	439	3.67e-42	SMART
MBT	448	543	7.5e-48	SMART
low complexity region	604	615	N/A	INTRINSIC
low complexity region	662	770	N/A	INTRINSIC
SAM	808	875	2.49e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218585

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
Dzip3	A	T	16: 48,958,465	M323K	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Galnt2	A	G	8: 124,343,315	I524V	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Grip1	T	C	10: 119,986,346	S405P	possibly damaging	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Map1b	A	T	13: 99,433,206	D1002E	unknown	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Ss18l1	G	A	2: 180,055,112	V109I	probably benign	Het
Tbx5	C	T	5: 119,853,598	H245Y	probably damaging	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Tnr	T	C	1: 159,888,314	V882A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in L3mbtl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:L3mbtl3	APN	10	26313846	critical splice donor site	probably null
IGL01357:L3mbtl3	APN	10	26330185	missense	unknown
IGL01712:L3mbtl3	APN	10	26276235	missense	probably damaging	0.96
IGL01759:L3mbtl3	APN	10	26331900	missense	unknown
IGL01928:L3mbtl3	APN	10	26330245	missense	unknown
IGL01955:L3mbtl3	APN	10	26318438	missense	unknown
IGL02674:L3mbtl3	APN	10	26282813	missense	unknown
IGL02731:L3mbtl3	APN	10	26344176	critical splice donor site	probably null
IGL03188:L3mbtl3	APN	10	26342617	missense	unknown
IGL03252:L3mbtl3	APN	10	26331812	splice site	probably benign
IGL03298:L3mbtl3	APN	10	26282798	missense	unknown
IGL03400:L3mbtl3	APN	10	26315526	missense	unknown
R0121:L3mbtl3	UTSW	10	26313870	missense	unknown
R0468:L3mbtl3	UTSW	10	26327732	missense	unknown
R0497:L3mbtl3	UTSW	10	26282874	splice site	probably benign
R0586:L3mbtl3	UTSW	10	26327834	missense	unknown
R0633:L3mbtl3	UTSW	10	26302685	missense	unknown
R0679:L3mbtl3	UTSW	10	26313933	nonsense	probably null
R1302:L3mbtl3	UTSW	10	26327769	missense	unknown
R2128:L3mbtl3	UTSW	10	26313868	missense	unknown
R2267:L3mbtl3	UTSW	10	26331857	nonsense	probably null
R3121:L3mbtl3	UTSW	10	26344221	intron	probably benign
R3410:L3mbtl3	UTSW	10	26339299	missense	unknown
R4237:L3mbtl3	UTSW	10	26340948	missense	unknown
R4257:L3mbtl3	UTSW	10	26280122	missense	unknown
R4308:L3mbtl3	UTSW	10	26282792	missense	unknown
R4359:L3mbtl3	UTSW	10	26327741	missense	unknown
R4407:L3mbtl3	UTSW	10	26313884	missense	unknown
R4613:L3mbtl3	UTSW	10	26282795	missense	unknown
R4663:L3mbtl3	UTSW	10	26337817	missense	unknown
R4843:L3mbtl3	UTSW	10	26331879	missense	unknown
R4886:L3mbtl3	UTSW	10	26292770	missense	unknown
R5158:L3mbtl3	UTSW	10	26303688	missense	unknown
R5247:L3mbtl3	UTSW	10	26327808	missense	unknown
R5580:L3mbtl3	UTSW	10	26303706	missense	unknown
R5966:L3mbtl3	UTSW	10	26331864	missense	unknown
R6508:L3mbtl3	UTSW	10	26318427	missense	unknown
R6563:L3mbtl3	UTSW	10	26302863	splice site	probably null
R6709:L3mbtl3	UTSW	10	26282797	missense	unknown
R6927:L3mbtl3	UTSW	10	26292669	nonsense	probably null
R6984:L3mbtl3	UTSW	10	26282855	missense	unknown
R7010:L3mbtl3	UTSW	10	26282861	critical splice acceptor site	probably null
R7229:L3mbtl3	UTSW	10	26292662	missense	unknown
R7231:L3mbtl3	UTSW	10	26339282	missense	unknown
R7296:L3mbtl3	UTSW	10	26282830	missense	unknown
R7363:L3mbtl3	UTSW	10	26340952	missense	unknown
R7490:L3mbtl3	UTSW	10	26339231	missense	unknown
R7775:L3mbtl3	UTSW	10	26352317	missense	unknown
R7815:L3mbtl3	UTSW	10	26280378	missense	unknown
R8272:L3mbtl3	UTSW	10	26303668	missense	unknown
R8762:L3mbtl3	UTSW	10	26276223	missense	probably damaging	1.00
R8925:L3mbtl3	UTSW	10	26344186	missense	unknown
R8927:L3mbtl3	UTSW	10	26344186	missense	unknown
R9043:L3mbtl3	UTSW	10	26280254	missense	unknown
R9228:L3mbtl3	UTSW	10	26336257	missense	unknown
Z1177:L3mbtl3	UTSW	10	26280402	nonsense	probably null
Z1177:L3mbtl3	UTSW	10	26302663	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGAAAATACCGCCACCAAATGT -3'
(R):5'- TCTGAAGTATCTTTAGCCCTGC -3'

Sequencing Primer
(F):5'- CGCCACCAAATGTAAAGCATATAAG -3'
(R):5'- GAAGTATCTTTAGCCCTGCATTTATG -3'

Posted On

2018-02-27