Incidental Mutation 'R6218:Rhobtb1'
ID 503849
Institutional Source Beutler Lab
Gene Symbol Rhobtb1
Ensembl Gene ENSMUSG00000019944
Gene Name Rho-related BTB domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.503) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 69151434-69291791 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 69270456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 284 (A284P)
Ref Sequence ENSEMBL: ENSMUSP00000131222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020101] [ENSMUST00000067908] [ENSMUST00000163497] [ENSMUST00000164034] [ENSMUST00000167384] [ENSMUST00000168117]
AlphaFold Q9DAK3
Predicted Effect probably benign
Transcript: ENSMUST00000020101
AA Change: A346P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020101
Gene: ENSMUSG00000019944
AA Change: A346P

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067908
AA Change: A346P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065095
Gene: ENSMUSG00000019944
AA Change: A346P

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163497
SMART Domains Protein: ENSMUSP00000129119
Gene: ENSMUSG00000019944

DomainStartEndE-ValueType
Pfam:Ras 16 96 1.8e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164034
AA Change: A346P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132068
Gene: ENSMUSG00000019944
AA Change: A346P

DomainStartEndE-ValueType
RHO 17 210 5.8e-34 SMART
low complexity region 225 246 N/A INTRINSIC
BTB 266 456 6.29e-13 SMART
BTB 484 582 9.03e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164876
Predicted Effect probably benign
Transcript: ENSMUST00000167384
AA Change: A284P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000131222
Gene: ENSMUSG00000019944
AA Change: A284P

DomainStartEndE-ValueType
PDB:3RYT|C 10 97 8e-6 PDB
SCOP:d1ky3a_ 15 150 8e-16 SMART
Blast:RHO 17 99 5e-50 BLAST
low complexity region 163 184 N/A INTRINSIC
BTB 204 394 6.29e-13 SMART
BTB 422 520 9.03e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168117
SMART Domains Protein: ENSMUSP00000131509
Gene: ENSMUSG00000019944

DomainStartEndE-ValueType
Pfam:Ras 16 97 1.9e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169569
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Rho family of the small GTPase superfamily. It contains a GTPase domain, a proline-rich region, a tandem of 2 BTB (broad complex, tramtrack, and bric-a-brac) domains, and a conserved C-terminal region. The protein plays a role in small GTPase-mediated signal transduction and the organization of the actin filament system. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Rhobtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Rhobtb1 APN 10 69270221 missense probably damaging 1.00
IGL01504:Rhobtb1 APN 10 69249698 missense probably damaging 1.00
IGL01561:Rhobtb1 APN 10 69270391 missense probably benign 0.17
IGL01924:Rhobtb1 APN 10 69270304 missense probably damaging 1.00
IGL02252:Rhobtb1 APN 10 69249685 missense probably damaging 1.00
IGL02334:Rhobtb1 APN 10 69285678 splice site probably benign
IGL02393:Rhobtb1 APN 10 69288987 missense probably damaging 1.00
IGL02514:Rhobtb1 APN 10 69289641 missense probably benign 0.00
IGL03192:Rhobtb1 APN 10 69248823 missense probably damaging 1.00
R1687:Rhobtb1 UTSW 10 69270279 missense probably damaging 1.00
R1713:Rhobtb1 UTSW 10 69272771 missense probably benign 0.05
R1713:Rhobtb1 UTSW 10 69272772 missense possibly damaging 0.61
R1750:Rhobtb1 UTSW 10 69279406 missense probably damaging 1.00
R2044:Rhobtb1 UTSW 10 69272863 splice site probably benign
R2312:Rhobtb1 UTSW 10 69270463 nonsense probably null
R2402:Rhobtb1 UTSW 10 69270424 missense probably benign 0.00
R3815:Rhobtb1 UTSW 10 69285693 missense possibly damaging 0.75
R4633:Rhobtb1 UTSW 10 69249613 splice site probably null
R4737:Rhobtb1 UTSW 10 69279497 critical splice donor site probably null
R4780:Rhobtb1 UTSW 10 69270153 missense probably benign 0.02
R4865:Rhobtb1 UTSW 10 69270724 missense probably benign 0.04
R5124:Rhobtb1 UTSW 10 69269901 critical splice acceptor site probably null
R5248:Rhobtb1 UTSW 10 69248785 missense probably damaging 1.00
R5304:Rhobtb1 UTSW 10 69269912 missense probably damaging 1.00
R5480:Rhobtb1 UTSW 10 69270733 missense possibly damaging 0.86
R5836:Rhobtb1 UTSW 10 69269989 missense probably damaging 1.00
R5951:Rhobtb1 UTSW 10 69270255 missense probably damaging 0.99
R6629:Rhobtb1 UTSW 10 69270316 missense possibly damaging 0.92
R6869:Rhobtb1 UTSW 10 69270226 missense probably damaging 0.99
R7081:Rhobtb1 UTSW 10 69266297 missense probably benign 0.29
R7260:Rhobtb1 UTSW 10 69270780 nonsense probably null
R7427:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
R7428:Rhobtb1 UTSW 10 69248824 missense probably damaging 1.00
R8054:Rhobtb1 UTSW 10 69248890 missense probably damaging 1.00
R8139:Rhobtb1 UTSW 10 69266290 missense probably damaging 1.00
R8144:Rhobtb1 UTSW 10 69289558 missense possibly damaging 0.89
R8712:Rhobtb1 UTSW 10 69270757 missense probably damaging 1.00
R8723:Rhobtb1 UTSW 10 69270271 missense probably damaging 1.00
R9116:Rhobtb1 UTSW 10 69270749 missense probably damaging 1.00
R9122:Rhobtb1 UTSW 10 69270823 missense probably damaging 1.00
R9216:Rhobtb1 UTSW 10 69272798 missense probably benign 0.22
R9409:Rhobtb1 UTSW 10 69270387 missense probably benign 0.09
Z1176:Rhobtb1 UTSW 10 69289551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGAGGAGCACATCTTTGC -3'
(R):5'- TAGAGGAATCTCAGCAGGGTCC -3'

Sequencing Primer
(F):5'- GCACATCTTTGCGCACCG -3'
(R):5'- AAAGGGCCTGACTGCATC -3'
Posted On 2018-02-27