Mutagenetix > Incidental Mutations

Incidental Mutation 'R6218:Grip1'

503851

Institutional Source

Beutler Lab

Gene Symbol

Grip1

Ensembl Gene

ENSMUSG00000034813

Gene Name

glutamate receptor interacting protein 1

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119453830-120087261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119986346 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 405 (S405P)

Ref Sequence

ENSEMBL: ENSMUSP00000122323 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]

AlphaFold

Q925T6

Predicted Effect

probably benign
Transcript: ENSMUST00000041962
AA Change: S354P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: S354P

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	354	367	N/A	INTRINSIC
low complexity region	388	405	N/A	INTRINSIC
low complexity region	413	424	N/A	INTRINSIC
PDZ	429	509	6.36e-17	SMART
PDZ	530	606	1.11e-16	SMART
PDZ	629	703	1.73e-18	SMART
PDZ	947	1019	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077871
AA Change: S327P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: S327P

Domain	Start	End	E-Value	Type
PDZ	36	110	4.86e-13	SMART
PDZ	134	212	6.4e-22	SMART
PDZ	235	310	1.97e-13	SMART
low complexity region	327	340	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	386	397	N/A	INTRINSIC
PDZ	402	482	6.36e-17	SMART
PDZ	503	579	1.11e-16	SMART
PDZ	602	676	1.73e-18	SMART
PDZ	920	992	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105262
AA Change: S353P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: S353P

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	946	1018	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127787

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138410
AA Change: S405P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: S405P

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	1013	1085	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139352

Predicted Effect

probably benign
Transcript: ENSMUST00000144825
AA Change: S326P

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: S326P

Domain	Start	End	E-Value	Type
PDZ	35	109	4.86e-13	SMART
PDZ	133	211	6.4e-22	SMART
PDZ	234	309	1.97e-13	SMART
low complexity region	326	339	N/A	INTRINSIC
low complexity region	360	377	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
PDZ	401	481	6.36e-17	SMART
PDZ	502	578	1.11e-16	SMART
PDZ	601	675	1.73e-18	SMART
PDZ	919	991	2.79e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144959
AA Change: S405P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: S405P

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147356
AA Change: S406P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: S406P

Domain	Start	End	E-Value	Type
PDZ	63	137	4.86e-13	SMART
PDZ	161	239	6.4e-22	SMART
PDZ	262	337	1.97e-13	SMART
low complexity region	394	422	N/A	INTRINSIC
low complexity region	440	457	N/A	INTRINSIC
low complexity region	465	476	N/A	INTRINSIC
PDZ	481	561	6.36e-17	SMART
PDZ	582	658	1.11e-16	SMART
PDZ	681	755	1.73e-18	SMART
PDZ	999	1071	2.79e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000147454
AA Change: S405P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: S405P

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	393	421	N/A	INTRINSIC
low complexity region	439	456	N/A	INTRINSIC
low complexity region	464	475	N/A	INTRINSIC
PDZ	480	560	6.36e-17	SMART
PDZ	581	657	1.11e-16	SMART
PDZ	680	754	1.73e-18	SMART
PDZ	998	1070	2.79e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147598

Predicted Effect

probably benign
Transcript: ENSMUST00000148954
AA Change: S353P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: S353P

Domain	Start	End	E-Value	Type
PDZ	62	136	4.86e-13	SMART
PDZ	160	238	6.4e-22	SMART
PDZ	261	336	1.97e-13	SMART
low complexity region	353	366	N/A	INTRINSIC
low complexity region	387	404	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
PDZ	428	508	6.36e-17	SMART
PDZ	529	605	1.11e-16	SMART
PDZ	628	702	1.73e-18	SMART
PDZ	961	1033	2.79e-13	SMART

Meta Mutation Damage Score

0.0693

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
Dzip3	A	T	16: 48,958,465	M323K	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Galnt2	A	G	8: 124,343,315	I524V	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
L3mbtl3	T	C	10: 26,292,747	I595V	unknown	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Map1b	A	T	13: 99,433,206	D1002E	unknown	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Ss18l1	G	A	2: 180,055,112	V109I	probably benign	Het
Tbx5	C	T	5: 119,853,598	H245Y	probably damaging	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Tnr	T	C	1: 159,888,314	V882A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in Grip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Grip1	APN	10	119931302	nonsense	probably null
IGL01374:Grip1	APN	10	120049368	missense	probably benign	0.03
IGL01592:Grip1	APN	10	119930003	missense	probably damaging	1.00
IGL02207:Grip1	APN	10	120075309	missense	probably damaging	1.00
IGL02222:Grip1	APN	10	119999809	missense	probably damaging	1.00
IGL02225:Grip1	APN	10	120049453	missense	probably damaging	1.00
IGL02447:Grip1	APN	10	120020071	missense	probably damaging	1.00
IGL02492:Grip1	APN	10	119930040	splice site	probably benign
IGL02522:Grip1	APN	10	119931249	missense	probably damaging	1.00
IGL02574:Grip1	APN	10	119942913	missense	probably damaging	1.00
IGL02718:Grip1	APN	10	120075515	makesense	probably null
IGL02751:Grip1	APN	10	119978577	missense	probably benign	0.08
IGL03221:Grip1	APN	10	119986394	missense	probably benign	0.00
IGL03377:Grip1	APN	10	120055032	missense	probably damaging	0.98
PIT4403001:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R0304:Grip1	UTSW	10	120075471	missense	probably benign	0.31
R0681:Grip1	UTSW	10	120010230	missense	probably damaging	1.00
R0760:Grip1	UTSW	10	120018078	missense	probably damaging	0.96
R1457:Grip1	UTSW	10	119986350	missense	possibly damaging	0.73
R1506:Grip1	UTSW	10	119978451	missense	probably damaging	1.00
R1541:Grip1	UTSW	10	120000543	missense	probably damaging	0.99
R1553:Grip1	UTSW	10	120054851	missense	probably damaging	1.00
R1709:Grip1	UTSW	10	119897715	missense	probably damaging	0.98
R2055:Grip1	UTSW	10	120049511	splice site	probably benign
R2059:Grip1	UTSW	10	120038698	missense	possibly damaging	0.80
R2261:Grip1	UTSW	10	119985584	missense	probably benign	0.00
R2475:Grip1	UTSW	10	119978496	missense	probably benign	0.01
R3777:Grip1	UTSW	10	119985630	critical splice donor site	probably null
R3849:Grip1	UTSW	10	119929958	missense	probably damaging	1.00
R3956:Grip1	UTSW	10	119930026	missense	probably damaging	1.00
R4643:Grip1	UTSW	10	120020101	missense	probably damaging	1.00
R4693:Grip1	UTSW	10	120000554	missense	probably benign	0.10
R4724:Grip1	UTSW	10	120038683	missense	probably benign	0.02
R4843:Grip1	UTSW	10	119930015	missense	probably damaging	1.00
R4884:Grip1	UTSW	10	120075306	missense	probably damaging	1.00
R4912:Grip1	UTSW	10	119931248	missense	probably damaging	1.00
R5185:Grip1	UTSW	10	119931259	missense	probably benign	0.37
R5291:Grip1	UTSW	10	120086969	missense	probably benign	0.04
R5293:Grip1	UTSW	10	119897735	missense	probably damaging	0.99
R5296:Grip1	UTSW	10	119929928	missense	probably damaging	1.00
R5302:Grip1	UTSW	10	120020077	missense	probably damaging	1.00
R5541:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R5792:Grip1	UTSW	10	119985480	missense	probably benign	0.07
R5861:Grip1	UTSW	10	119929970	missense	probably damaging	1.00
R5905:Grip1	UTSW	10	119985492	missense	probably benign	0.02
R5949:Grip1	UTSW	10	120050242	missense	probably benign	0.00
R6112:Grip1	UTSW	10	119993232	missense	probably benign	0.00
R6166:Grip1	UTSW	10	120072718	missense	probably damaging	1.00
R6167:Grip1	UTSW	10	119897797	critical splice donor site	probably null
R6193:Grip1	UTSW	10	120038314	missense	probably damaging	1.00
R6267:Grip1	UTSW	10	120075464	nonsense	probably null
R6296:Grip1	UTSW	10	120075464	nonsense	probably null
R6490:Grip1	UTSW	10	119986424	missense	possibly damaging	0.82
R6543:Grip1	UTSW	10	119985594	missense	probably benign	0.00
R6558:Grip1	UTSW	10	119454383	missense	probably benign	0.00
R6995:Grip1	UTSW	10	119986470	missense	probably damaging	0.99
R7122:Grip1	UTSW	10	120035374	missense	possibly damaging	0.48
R7157:Grip1	UTSW	10	119945156	missense	probably damaging	1.00
R7410:Grip1	UTSW	10	120020020	missense	probably benign	0.01
R7447:Grip1	UTSW	10	120086966	missense	probably benign	0.01
R7539:Grip1	UTSW	10	120054871	missense	probably benign	0.17
R7586:Grip1	UTSW	10	120077138	splice site	probably null
R7768:Grip1	UTSW	10	120038397	missense	probably damaging	0.98
R7831:Grip1	UTSW	10	120018106	missense	probably damaging	1.00
R7896:Grip1	UTSW	10	119978545	missense	possibly damaging	0.53
R8103:Grip1	UTSW	10	119978535	missense	probably benign	0.00
R8254:Grip1	UTSW	10	120054905	nonsense	probably null
R8688:Grip1	UTSW	10	119999904	missense	probably benign	0.12
R8823:Grip1	UTSW	10	119975951	missense
R8837:Grip1	UTSW	10	119930035	missense	probably damaging	1.00
R8885:Grip1	UTSW	10	119454287	start gained	probably benign
R8951:Grip1	UTSW	10	120038604	missense	possibly damaging	0.85
R9042:Grip1	UTSW	10	120000533	missense	probably benign	0.14
R9045:Grip1	UTSW	10	120035451	missense	probably damaging	0.97
R9237:Grip1	UTSW	10	120075405	missense	probably benign	0.07
R9254:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
R9259:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9260:Grip1	UTSW	10	120038664	missense	possibly damaging	0.63
R9307:Grip1	UTSW	10	119985549	missense	probably benign	0.01
R9379:Grip1	UTSW	10	119945056	missense	probably damaging	1.00
RF011:Grip1	UTSW	10	119931315	missense	probably null	0.97
Z1176:Grip1	UTSW	10	119819483	unclassified	probably benign
Z1177:Grip1	UTSW	10	119986444	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TAAGTCTGTGTGCAGCCACG -3'
(R):5'- CATCTTCTGGAGACCAAATGGAC -3'

Sequencing Primer
(F):5'- GCTATGGAGAGTCCTCTGAAACTC -3'
(R):5'- TTCTGGAGACCAAATGGACCATCTG -3'

Posted On

2018-02-27