Incidental Mutation 'R6218:Gpr22'
ID503858
Institutional Source Beutler Lab
Gene Symbol Gpr22
Ensembl Gene ENSMUSG00000044067
Gene NameG protein-coupled receptor 22
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6218 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31706867-31713947 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 31711617 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 14 (K14*)
Ref Sequence ENSEMBL: ENSMUSP00000056125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000057783] [ENSMUST00000174480] [ENSMUST00000176710]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000057783
AA Change: K14*
SMART Domains Protein: ENSMUSP00000056125
Gene: ENSMUSG00000044067
AA Change: K14*

DomainStartEndE-ValueType
low complexity region 58 64 N/A INTRINSIC
Pfam:7tm_1 95 403 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174480
SMART Domains Protein: ENSMUSP00000134674
Gene: ENSMUSG00000044067

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 186 3.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176710
SMART Domains Protein: ENSMUSP00000134839
Gene: ENSMUSG00000044067

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 366 1.4e-26 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased response to aortic banding including decreased fractional shortening and decompensated heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Gpr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gpr22 APN 12 31708710 unclassified probably benign
IGL01521:Gpr22 APN 12 31708710 unclassified probably benign
IGL01533:Gpr22 APN 12 31708710 unclassified probably benign
IGL01585:Gpr22 APN 12 31709337 missense probably benign 0.23
IGL01601:Gpr22 APN 12 31710045 splice site probably benign
IGL01608:Gpr22 APN 12 31708780 nonsense probably null
IGL02307:Gpr22 APN 12 31708740 missense possibly damaging 0.95
IGL02440:Gpr22 APN 12 31709140 missense probably damaging 0.99
IGL02863:Gpr22 APN 12 31710007 missense probably benign 0.36
IGL03163:Gpr22 APN 12 31709172 missense possibly damaging 0.68
R0078:Gpr22 UTSW 12 31711641 missense probably benign
R0358:Gpr22 UTSW 12 31709982 missense probably benign 0.03
R0395:Gpr22 UTSW 12 31709462 missense possibly damaging 0.48
R0452:Gpr22 UTSW 12 31708794 missense possibly damaging 0.69
R0729:Gpr22 UTSW 12 31709313 missense probably damaging 1.00
R1295:Gpr22 UTSW 12 31709514 missense probably benign 0.01
R1991:Gpr22 UTSW 12 31709203 missense probably benign
R4201:Gpr22 UTSW 12 31708913 nonsense probably null
R5203:Gpr22 UTSW 12 31709788 missense probably damaging 1.00
R5505:Gpr22 UTSW 12 31709725 missense probably damaging 1.00
R5541:Gpr22 UTSW 12 31709349 missense probably damaging 0.97
R6844:Gpr22 UTSW 12 31709952 missense probably benign
R7448:Gpr22 UTSW 12 31709515 missense probably benign 0.06
R7956:Gpr22 UTSW 12 31709220 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTGAAATCCTGTGAAAATGGGC -3'
(R):5'- GTGCTGTTCTTTAGATATCCATTAGCC -3'

Sequencing Primer
(F):5'- TCTGAACTGGAAGACTGAACATC -3'
(R):5'- ATCCATTAGCCAACTAAATCTCATC -3'
Posted On2018-02-27