Incidental Mutation 'R6218:Eci2'
ID 503861
Institutional Source Beutler Lab
Gene Symbol Eci2
Ensembl Gene ENSMUSG00000021417
Gene Name enoyl-Coenzyme A delta isomerase 2
Synonyms DRS1, HCA88, ACBD2, Peci
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 34977748-35027096 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to A at 34993065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021854] [ENSMUST00000110251] [ENSMUST00000163280] [ENSMUST00000167036] [ENSMUST00000169759] [ENSMUST00000170538] [ENSMUST00000170989] [ENSMUST00000171229] [ENSMUST00000171258] [ENSMUST00000178421]
AlphaFold Q9WUR2
Predicted Effect probably null
Transcript: ENSMUST00000021854
SMART Domains Protein: ENSMUSP00000021854
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 2.2e-33 PFAM
Pfam:ECH 108 354 1.4e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084345
Predicted Effect probably null
Transcript: ENSMUST00000110251
SMART Domains Protein: ENSMUSP00000105880
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 24 108 1.7e-33 PFAM
Pfam:ECH 128 374 1.2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130003
Predicted Effect probably null
Transcript: ENSMUST00000163280
SMART Domains Protein: ENSMUSP00000126500
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 8e-34 PFAM
Pfam:ECH 108 213 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166109
Predicted Effect probably null
Transcript: ENSMUST00000167036
SMART Domains Protein: ENSMUSP00000130076
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 6.6e-34 PFAM
Pfam:ECH 108 191 2.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169759
SMART Domains Protein: ENSMUSP00000130283
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 1.7e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170538
SMART Domains Protein: ENSMUSP00000129428
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 9.1e-34 PFAM
Pfam:ECH 108 228 1.2e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170989
SMART Domains Protein: ENSMUSP00000129477
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 6.9e-34 PFAM
Pfam:ECH 108 202 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171079
Predicted Effect probably null
Transcript: ENSMUST00000171229
SMART Domains Protein: ENSMUSP00000131735
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 38 118 3e-32 PFAM
Pfam:ECH_1 143 390 3.8e-42 PFAM
Pfam:ECH_2 148 389 6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171258
SMART Domains Protein: ENSMUSP00000129164
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 4.5e-34 PFAM
Pfam:ECH 108 170 2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178421
SMART Domains Protein: ENSMUSP00000137411
Gene: ENSMUSG00000021417

DomainStartEndE-ValueType
Pfam:ACBP 4 88 2.2e-33 PFAM
Pfam:ECH 108 354 1.4e-42 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Eci2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Eci2 APN 13 34990329 nonsense probably null
IGL02057:Eci2 APN 13 34990776 missense probably damaging 1.00
IGL02141:Eci2 APN 13 34978673 missense probably benign 0.00
IGL03149:Eci2 APN 13 34988313 missense probably benign 0.41
BB001:Eci2 UTSW 13 34993070 nonsense probably null
BB011:Eci2 UTSW 13 34993070 nonsense probably null
R1175:Eci2 UTSW 13 34993104 missense probably damaging 1.00
R1488:Eci2 UTSW 13 34977933 missense probably benign 0.00
R2110:Eci2 UTSW 13 34990716 critical splice donor site probably null
R2111:Eci2 UTSW 13 34990716 critical splice donor site probably null
R3704:Eci2 UTSW 13 34993233 splice site probably benign
R5342:Eci2 UTSW 13 34978724 missense probably benign 0.31
R5701:Eci2 UTSW 13 34990267 missense possibly damaging 0.89
R6027:Eci2 UTSW 13 34985947 splice site probably null
R6246:Eci2 UTSW 13 34990198 missense probably damaging 1.00
R6357:Eci2 UTSW 13 34993099 missense possibly damaging 0.87
R7924:Eci2 UTSW 13 34993070 nonsense probably null
R8410:Eci2 UTSW 13 34978035 missense probably benign
R8783:Eci2 UTSW 13 34990197 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCTCCAAACATGTG -3'
(R):5'- TAGTGTCCTGCAGGTCTTCAG -3'

Sequencing Primer
(F):5'- CTCTTTATTCTGGAGAGAAGCAGAG -3'
(R):5'- GTCCTGCAGGTCTTCAGATTACAAG -3'
Posted On 2018-02-27