Mutagenetix > Incidental Mutation

Incidental Mutation 'R6218:Map1b'

503862

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99433206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1002 (D1002E)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: D1002E

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: D1002E

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.0604

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
Dzip3	A	T	16: 48,958,465	M323K	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Galnt2	A	G	8: 124,343,315	I524V	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Grip1	T	C	10: 119,986,346	S405P	possibly damaging	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
L3mbtl3	T	C	10: 26,292,747	I595V	unknown	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Ss18l1	G	A	2: 180,055,112	V109I	probably benign	Het
Tbx5	C	T	5: 119,853,598	H245Y	probably damaging	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Tnr	T	C	1: 159,888,314	V882A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGGTATCCGTACTGCTCCTC -3'
(R):5'- GCTGGTTTTGAAGAATCCTCAGAG -3'

Sequencing Primer
(F):5'- CTGTGACTCCAGCCTCAGC -3'
(R):5'- TTTTGAAGAATCCTCAGAGACCGG -3'

Posted On

2018-02-27