Incidental Mutation 'R6218:Ddhd1'
ID 503864
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene Name DDHD domain containing 1
Synonyms 4921528E07Rik, 9630061G18Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 45830628-45895600 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45851633 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 141 (L141P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051310
AA Change: L481P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: L481P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087320
AA Change: L515P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: L515P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111828
AA Change: L481P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: L481P

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129599
Predicted Effect probably damaging
Transcript: ENSMUST00000141487
AA Change: L141P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697
AA Change: L141P

DomainStartEndE-ValueType
Blast:DDHD 111 149 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227258
Meta Mutation Damage Score 0.6701 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,728,730 (GRCm39) Q38K probably benign Het
9930111J21Rik2 A T 11: 48,910,134 (GRCm39) N766K probably benign Het
Adam15 A C 3: 89,251,190 (GRCm39) I505S probably benign Het
Apc2 T C 10: 80,142,254 (GRCm39) M391T probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bclaf1 A G 10: 20,210,374 (GRCm39) S840G probably benign Het
Cacna2d4 A G 6: 119,216,021 (GRCm39) Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,724,863 (GRCm39) probably null Het
Dnaaf3 A T 7: 4,526,671 (GRCm39) S469T probably benign Het
Dzip3 A T 16: 48,778,828 (GRCm39) M323K possibly damaging Het
Eci2 T A 13: 35,177,048 (GRCm39) probably null Het
Fam227b A T 2: 125,968,882 (GRCm39) V64E probably damaging Het
Galnt2 A G 8: 125,070,054 (GRCm39) I524V probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm3443 T A 19: 21,533,110 (GRCm39) S25T probably damaging Het
Gpr22 T A 12: 31,761,616 (GRCm39) K14* probably null Het
Grip1 T C 10: 119,822,251 (GRCm39) S405P possibly damaging Het
Helz2 T C 2: 180,877,738 (GRCm39) H1020R probably damaging Het
Helz2 C A 2: 180,874,087 (GRCm39) V2136L probably benign Het
Il36rn G A 2: 24,167,502 (GRCm39) probably benign Het
Iqsec1 T A 6: 90,666,617 (GRCm39) S607C probably damaging Het
Irag1 G A 7: 110,476,112 (GRCm39) T819M probably benign Het
Klhl2 A T 8: 65,205,801 (GRCm39) Y373* probably null Het
L3mbtl3 T C 10: 26,168,645 (GRCm39) I595V unknown Het
Large2 T C 2: 92,200,981 (GRCm39) D65G probably damaging Het
Lrrfip1 T C 1: 91,009,881 (GRCm39) Y122H probably damaging Het
Map1b A T 13: 99,569,714 (GRCm39) D1002E unknown Het
Mink1 C T 11: 70,489,720 (GRCm39) T59I possibly damaging Het
Myo7b T C 18: 32,092,507 (GRCm39) N2097D probably benign Het
Nbea C A 3: 55,535,905 (GRCm39) C2893F probably damaging Het
Nlgn1 A T 3: 25,490,257 (GRCm39) V490E probably damaging Het
Or2w1b G A 13: 21,300,401 (GRCm39) E180K probably damaging Het
Or2y3 A G 17: 38,393,620 (GRCm39) M83T probably damaging Het
Or4c123 G T 2: 89,127,306 (GRCm39) H103N probably damaging Het
Or4f62 T C 2: 111,986,701 (GRCm39) I135T probably damaging Het
Or4k2 C A 14: 50,424,135 (GRCm39) D180Y probably damaging Het
Pctp A G 11: 89,878,144 (GRCm39) I130T probably benign Het
Pdcl3 T C 1: 39,027,152 (GRCm39) probably null Het
Pheta2 T A 15: 82,227,917 (GRCm39) H145Q probably benign Het
Pira12 A T 7: 3,897,031 (GRCm39) S602T possibly damaging Het
Pkp1 T C 1: 135,807,646 (GRCm39) K541E probably damaging Het
Plekhh2 G A 17: 84,898,992 (GRCm39) V990I probably benign Het
Ppp1r3a A T 6: 14,718,430 (GRCm39) V828D probably damaging Het
Prrc2b T C 2: 32,098,823 (GRCm39) Y712H probably damaging Het
Prune2 T C 19: 17,098,926 (GRCm39) S1477P probably benign Het
Psma5 A G 3: 108,187,118 (GRCm39) K239R probably benign Het
Rhobtb1 G C 10: 69,106,286 (GRCm39) A284P probably benign Het
Samsn1 G A 16: 75,742,162 (GRCm39) noncoding transcript Het
Scel A G 14: 103,809,478 (GRCm39) T273A probably benign Het
Slc22a5 T A 11: 53,782,444 (GRCm39) probably benign Het
Slc25a37 A T 14: 69,486,953 (GRCm39) M110K possibly damaging Het
Slc6a2 A T 8: 93,708,609 (GRCm39) M242L probably benign Het
Slc8a3 C A 12: 81,246,341 (GRCm39) W904L probably benign Het
Ss18l1 G A 2: 179,696,905 (GRCm39) V109I probably benign Het
Tbx5 C T 5: 119,991,663 (GRCm39) H245Y probably damaging Het
Thumpd2 C A 17: 81,360,342 (GRCm39) L244F probably damaging Het
Tmem107 T A 11: 68,962,241 (GRCm39) V66E probably damaging Het
Tnr T C 1: 159,715,884 (GRCm39) V882A possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttbk1 A G 17: 46,781,733 (GRCm39) V340A possibly damaging Het
Veph1 T C 3: 66,162,481 (GRCm39) E59G probably damaging Het
Vmn1r234 T A 17: 21,449,983 (GRCm39) M299K possibly damaging Het
Vps13b T C 15: 35,770,610 (GRCm39) Y2018H probably benign Het
Zbtb11 A G 16: 55,818,436 (GRCm39) E620G probably benign Het
Zfp418 A G 7: 7,185,627 (GRCm39) H530R possibly damaging Het
Zfp764l1 C T 7: 126,992,581 (GRCm39) A10T possibly damaging Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45,854,008 (GRCm39) missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45,867,037 (GRCm39) missense probably null 0.98
IGL02176:Ddhd1 APN 14 45,854,057 (GRCm39) missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45,842,663 (GRCm39) unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45,858,240 (GRCm39) missense probably damaging 1.00
PIT4434001:Ddhd1 UTSW 14 45,848,062 (GRCm39) missense possibly damaging 0.62
R0037:Ddhd1 UTSW 14 45,847,967 (GRCm39) missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45,848,147 (GRCm39) missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45,833,049 (GRCm39) missense probably damaging 1.00
R1237:Ddhd1 UTSW 14 45,839,107 (GRCm39) missense probably benign 0.01
R1401:Ddhd1 UTSW 14 45,842,508 (GRCm39) critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45,833,004 (GRCm39) missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45,842,566 (GRCm39) missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45,848,081 (GRCm39) missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45,846,447 (GRCm39) missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45,894,729 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,894,720 (GRCm39) missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45,848,030 (GRCm39) missense probably benign 0.00
R4541:Ddhd1 UTSW 14 45,860,313 (GRCm39) nonsense probably null
R4737:Ddhd1 UTSW 14 45,866,278 (GRCm39) intron probably benign
R5105:Ddhd1 UTSW 14 45,894,864 (GRCm39) missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45,840,164 (GRCm39) missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45,840,125 (GRCm39) missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45,856,971 (GRCm39) splice site probably null
R6671:Ddhd1 UTSW 14 45,894,689 (GRCm39) frame shift probably null
R6787:Ddhd1 UTSW 14 45,894,976 (GRCm39) missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45,840,138 (GRCm39) missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45,895,263 (GRCm39) missense probably damaging 1.00
R7213:Ddhd1 UTSW 14 45,895,210 (GRCm39) missense probably benign 0.41
R7261:Ddhd1 UTSW 14 45,894,688 (GRCm39) missense probably damaging 1.00
R7522:Ddhd1 UTSW 14 45,895,104 (GRCm39) missense possibly damaging 0.47
R7920:Ddhd1 UTSW 14 45,894,927 (GRCm39) missense probably damaging 0.96
R8736:Ddhd1 UTSW 14 45,836,642 (GRCm39) missense probably benign 0.30
R8880:Ddhd1 UTSW 14 45,846,430 (GRCm39) missense probably benign
R9140:Ddhd1 UTSW 14 45,894,918 (GRCm39) missense probably benign 0.12
R9393:Ddhd1 UTSW 14 45,894,685 (GRCm39) missense probably damaging 1.00
R9398:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9399:Ddhd1 UTSW 14 45,895,117 (GRCm39) missense possibly damaging 0.60
R9502:Ddhd1 UTSW 14 45,894,679 (GRCm39) missense possibly damaging 0.75
R9687:Ddhd1 UTSW 14 45,848,190 (GRCm39) missense probably damaging 0.97
Z1177:Ddhd1 UTSW 14 45,895,051 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTCCTGAGTGTGGGACTAAAGG -3'
(R):5'- CCCCACTGGTGTTTAATATTTCAGTAG -3'

Sequencing Primer
(F):5'- ACTAAAGGTGTGCCCTGC -3'
(R):5'- TTCAGTAGTGACCTCTGTAACTG -3'
Posted On 2018-02-27