Incidental Mutation 'R6218:Olfr730'
ID 503865
Institutional Source Beutler Lab
Gene Symbol Olfr730
Ensembl Gene ENSMUSG00000109835
Gene Name olfactory receptor 730
Synonyms GA_x6K02T2PMLR-5881670-5880717, MOR247-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 50183296-50188198 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 50186678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 180 (D180Y)
Ref Sequence ENSEMBL: ENSMUSP00000145742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051453] [ENSMUST00000205837]
AlphaFold E9Q8M3
Predicted Effect probably damaging
Transcript: ENSMUST00000051453
AA Change: D181Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060325
Gene: ENSMUSG00000109835
AA Change: D181Y

DomainStartEndE-ValueType
Pfam:7tm_4 32 305 3.4e-44 PFAM
Pfam:7tm_1 42 288 1.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205837
AA Change: D180Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215779
Meta Mutation Damage Score 0.4507 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Olfr730
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Olfr730 APN 14 50186648 missense probably benign 0.36
IGL02976:Olfr730 APN 14 50186432 nonsense probably null
IGL03065:Olfr730 APN 14 50187008 missense probably damaging 1.00
IGL03122:Olfr730 APN 14 50187004 missense probably damaging 0.98
R0277:Olfr730 UTSW 14 50186332 missense probably null 0.06
R1081:Olfr730 UTSW 14 50187197 missense probably damaging 1.00
R1189:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R1501:Olfr730 UTSW 14 50187082 missense probably damaging 0.99
R2680:Olfr730 UTSW 14 50186847 nonsense probably null
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R2869:Olfr730 UTSW 14 50186354 missense probably benign 0.08
R3415:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3417:Olfr730 UTSW 14 50186612 missense possibly damaging 0.60
R3721:Olfr730 UTSW 14 50186680 missense probably damaging 1.00
R4864:Olfr730 UTSW 14 50186582 missense probably damaging 0.97
R5037:Olfr730 UTSW 14 50186288 missense probably benign 0.00
R5349:Olfr730 UTSW 14 50186773 nonsense probably null
R5738:Olfr730 UTSW 14 50186648 missense probably benign 0.09
R5779:Olfr730 UTSW 14 50186746 missense possibly damaging 0.82
R5853:Olfr730 UTSW 14 50186869 missense possibly damaging 0.88
R5918:Olfr730 UTSW 14 50186968 missense probably benign
R6166:Olfr730 UTSW 14 50186768 missense probably benign
R6196:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6220:Olfr730 UTSW 14 50186678 missense probably damaging 1.00
R6561:Olfr730 UTSW 14 50186318 missense probably damaging 1.00
R6798:Olfr730 UTSW 14 50187127 missense probably benign 0.00
R6834:Olfr730 UTSW 14 50186483 missense probably benign 0.12
R7174:Olfr730 UTSW 14 50186696 missense probably benign 0.00
R7406:Olfr730 UTSW 14 50186558 missense probably damaging 0.97
R7592:Olfr730 UTSW 14 50186563 missense probably damaging 1.00
R7886:Olfr730 UTSW 14 50186564 missense probably damaging 1.00
R8081:Olfr730 UTSW 14 50186368 missense probably damaging 1.00
R8280:Olfr730 UTSW 14 50186266 nonsense probably null
R8393:Olfr730 UTSW 14 50186885 nonsense probably null
R8526:Olfr730 UTSW 14 50186262 splice site probably null
R8683:Olfr730 UTSW 14 50186746 missense possibly damaging 0.82
R8936:Olfr730 UTSW 14 50186542 missense possibly damaging 0.82
R9285:Olfr730 UTSW 14 50186665 missense probably benign 0.40
X0023:Olfr730 UTSW 14 50187201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGAAAGAGCCTTAGATGATCC -3'
(R):5'- CCACCTGTTCACTGGTACTGAG -3'

Sequencing Primer
(F):5'- AGAGCCTTAGATGATCCTTTGGAAG -3'
(R):5'- TCTTTTGACAGGTATATTGCAATTTG -3'
Posted On 2018-02-27