Incidental Mutation 'R6218:Scel'
ID 503867
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103572042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 273 (T273A)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: T273A

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: T273A

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: T273A

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ATTGCCCGGAATGATCTCTGC -3'
(R):5'- ACCTAGGTTGCACACTTCTTATG -3'

Sequencing Primer
(F):5'- TCTGCTCTTCCATTCAATGAGAG -3'
(R):5'- TGACTAGGTCACTGACATCATGACG -3'
Posted On 2018-02-27