Incidental Mutation 'R6218:Fam109b'
ID 503869
Institutional Source Beutler Lab
Gene Symbol Fam109b
Ensembl Gene ENSMUSG00000049687
Gene Name family with sequence similarity 109, member B
Synonyms C920005C14Rik, Ses2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 82338942-82345743 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82343716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 145 (H145Q)
Ref Sequence ENSEMBL: ENSMUSP00000124703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023086] [ENSMUST00000023088] [ENSMUST00000050349] [ENSMUST00000159054] [ENSMUST00000160994] [ENSMUST00000161178] [ENSMUST00000161892] [ENSMUST00000229388] [ENSMUST00000229733] [ENSMUST00000229948] [ENSMUST00000230360] [ENSMUST00000230380]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023086
SMART Domains Protein: ENSMUSP00000023086
Gene: ENSMUSG00000022452

DomainStartEndE-ValueType
Pfam:DDDD 33 107 1.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023088
SMART Domains Protein: ENSMUSP00000023088
Gene: ENSMUSG00000022453

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Melibiase_2 25 394 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050349
AA Change: H145Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000060598
Gene: ENSMUSG00000049687
AA Change: H145Q

DomainStartEndE-ValueType
PH 18 123 1.02e-10 SMART
coiled coil region 128 150 N/A INTRINSIC
Blast:PH 192 242 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083025
Predicted Effect probably benign
Transcript: ENSMUST00000159054
SMART Domains Protein: ENSMUSP00000125429
Gene: ENSMUSG00000022452

DomainStartEndE-ValueType
Pfam:DDDD 8 70 1.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159942
Predicted Effect probably benign
Transcript: ENSMUST00000160994
Predicted Effect probably benign
Transcript: ENSMUST00000161178
AA Change: H145Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124703
Gene: ENSMUSG00000049687
AA Change: H145Q

DomainStartEndE-ValueType
PH 18 123 1.02e-10 SMART
coiled coil region 128 150 N/A INTRINSIC
Blast:PH 192 242 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162983
Predicted Effect probably benign
Transcript: ENSMUST00000229388
Predicted Effect probably benign
Transcript: ENSMUST00000229733
Predicted Effect probably benign
Transcript: ENSMUST00000229948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230165
Predicted Effect probably benign
Transcript: ENSMUST00000230360
Predicted Effect probably benign
Transcript: ENSMUST00000230380
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Fam109b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02178:Fam109b APN 15 82343326 missense possibly damaging 0.76
R0357:Fam109b UTSW 15 82343316 missense probably damaging 1.00
R1324:Fam109b UTSW 15 82343498 missense probably damaging 1.00
R8890:Fam109b UTSW 15 82343417 missense probably damaging 1.00
R9199:Fam109b UTSW 15 82343676 missense probably damaging 1.00
R9211:Fam109b UTSW 15 82341026 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTATTGGAAGGCTGCAC -3'
(R):5'- GTAACTCCCACTCGGTCAAATC -3'

Sequencing Primer
(F):5'- TCCTGTACCCGAGGAGTTC -3'
(R):5'- GTCAAATCCCGACCTATTGGC -3'
Posted On 2018-02-27