Mutagenetix > Incidental Mutation

Incidental Mutation 'R6218:Dzip3'

503870

Institutional Source

Beutler Lab

Gene Symbol

Dzip3

Ensembl Gene

ENSMUSG00000064061

Gene Name

DAZ interacting protein 3, zinc finger

Synonyms

2A-HUB, 6430549P11Rik, 2310047C04Rik

Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48924232-48994165 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48958465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 323 (M323K)

Ref Sequence

ENSEMBL: ENSMUSP00000113344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114516
AA Change: M323K

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: M323K

Domain	Start	End	E-Value	Type
low complexity region	451	472	N/A	INTRINSIC
coiled coil region	548	568	N/A	INTRINSIC
coiled coil region	599	650	N/A	INTRINSIC
low complexity region	743	754	N/A	INTRINSIC
low complexity region	883	891	N/A	INTRINSIC
RING	938	977	2.09e-7	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121869
AA Change: M323K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: M323K

Domain	Start	End	E-Value	Type
low complexity region	657	678	N/A	INTRINSIC
coiled coil region	754	774	N/A	INTRINSIC
coiled coil region	805	856	N/A	INTRINSIC
low complexity region	949	960	N/A	INTRINSIC
low complexity region	1089	1097	N/A	INTRINSIC
RING	1144	1183	2.09e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133377

Meta Mutation Damage Score

0.1828

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Galnt2	A	G	8: 124,343,315	I524V	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Grip1	T	C	10: 119,986,346	S405P	possibly damaging	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
L3mbtl3	T	C	10: 26,292,747	I595V	unknown	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Map1b	A	T	13: 99,433,206	D1002E	unknown	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Ss18l1	G	A	2: 180,055,112	V109I	probably benign	Het
Tbx5	C	T	5: 119,853,598	H245Y	probably damaging	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Tnr	T	C	1: 159,888,314	V882A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in Dzip3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:Dzip3	APN	16	48928415	missense	probably damaging	1.00
IGL00931:Dzip3	APN	16	48935497	critical splice donor site	probably null
IGL01109:Dzip3	APN	16	48929674	missense	probably benign	0.27
IGL01121:Dzip3	APN	16	48944881	missense	probably benign	0.10
IGL01328:Dzip3	APN	16	48972258	missense	probably damaging	1.00
IGL01729:Dzip3	APN	16	48928363	missense	possibly damaging	0.78
IGL02044:Dzip3	APN	16	48948427	missense	possibly damaging	0.90
IGL02051:Dzip3	APN	16	48972254	missense	probably benign	0.01
IGL02115:Dzip3	APN	16	48948485	missense	probably benign	0.00
IGL02125:Dzip3	APN	16	48927596	missense	probably damaging	1.00
IGL02136:Dzip3	APN	16	48927582	missense	possibly damaging	0.94
IGL02244:Dzip3	APN	16	48980988	missense	probably benign	0.01
IGL02253:Dzip3	APN	16	48944924	missense	probably benign	0.34
IGL02412:Dzip3	APN	16	48958457	missense	probably benign	0.00
IGL02452:Dzip3	APN	16	48938537	splice site	probably benign
IGL02481:Dzip3	APN	16	48975551	splice site	probably benign
IGL02499:Dzip3	APN	16	48933850	missense	probably damaging	1.00
IGL02511:Dzip3	APN	16	48936980	missense	possibly damaging	0.75
IGL02519:Dzip3	APN	16	48928396	missense	probably damaging	1.00
IGL02610:Dzip3	APN	16	48951653	missense	probably damaging	1.00
IGL03129:Dzip3	APN	16	48942083	missense	possibly damaging	0.51
IGL03342:Dzip3	APN	16	48929623	missense	probably damaging	0.98
IGL03493:Dzip3	APN	16	48951696	missense	probably benign	0.32
corvette	UTSW	16	48927540	critical splice donor site	probably null
dazwick	UTSW	16	48958465	missense	possibly damaging	0.90
1mM(1):Dzip3	UTSW	16	48951557	missense	probably damaging	1.00
PIT4651001:Dzip3	UTSW	16	48944878	missense	probably benign
R0313:Dzip3	UTSW	16	48937061	missense	probably damaging	0.99
R0483:Dzip3	UTSW	16	48947713	missense	possibly damaging	0.94
R0504:Dzip3	UTSW	16	48959643	splice site	probably benign
R0744:Dzip3	UTSW	16	48959675	missense	probably damaging	1.00
R0800:Dzip3	UTSW	16	48953808	splice site	probably benign
R0927:Dzip3	UTSW	16	48975477	missense	probably damaging	0.99
R0931:Dzip3	UTSW	16	48951558	missense	probably damaging	1.00
R1170:Dzip3	UTSW	16	48961208	missense	probably damaging	1.00
R1203:Dzip3	UTSW	16	48951817	missense	probably damaging	1.00
R1205:Dzip3	UTSW	16	48951681	missense	probably damaging	1.00
R1442:Dzip3	UTSW	16	48945622	missense	probably benign	0.19
R1526:Dzip3	UTSW	16	48937006	missense	probably damaging	1.00
R1560:Dzip3	UTSW	16	48951540	splice site	probably null
R1585:Dzip3	UTSW	16	48977878	splice site	probably benign
R1682:Dzip3	UTSW	16	48958417	critical splice donor site	probably null
R1957:Dzip3	UTSW	16	48927593	missense	probably damaging	1.00
R2472:Dzip3	UTSW	16	48953787	missense	possibly damaging	0.85
R2571:Dzip3	UTSW	16	48972218	splice site	probably null
R3040:Dzip3	UTSW	16	48928324	missense	probably damaging	1.00
R3081:Dzip3	UTSW	16	48927558	missense	probably damaging	1.00
R3615:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3616:Dzip3	UTSW	16	48937063	missense	probably damaging	1.00
R3786:Dzip3	UTSW	16	48975543	missense	probably benign	0.08
R3851:Dzip3	UTSW	16	48950013	missense	possibly damaging	0.94
R4097:Dzip3	UTSW	16	48958489	nonsense	probably null
R4371:Dzip3	UTSW	16	48943455	critical splice donor site	probably null
R4612:Dzip3	UTSW	16	48952040	nonsense	probably null
R4671:Dzip3	UTSW	16	48979590	nonsense	probably null
R4695:Dzip3	UTSW	16	48951561	missense	probably damaging	1.00
R4696:Dzip3	UTSW	16	48925969	unclassified	probably benign
R4769:Dzip3	UTSW	16	48938474	missense	probably damaging	0.97
R5063:Dzip3	UTSW	16	48953754	nonsense	probably null
R5321:Dzip3	UTSW	16	48957675	missense	possibly damaging	0.95
R5764:Dzip3	UTSW	16	48927361	intron	probably benign
R6020:Dzip3	UTSW	16	48951842	missense	probably damaging	1.00
R6300:Dzip3	UTSW	16	48951807	missense	probably damaging	1.00
R6365:Dzip3	UTSW	16	48931273	missense	probably damaging	0.96
R6778:Dzip3	UTSW	16	48982083	missense	probably benign	0.00
R6915:Dzip3	UTSW	16	48942125	missense	possibly damaging	0.72
R7047:Dzip3	UTSW	16	48982126	missense	probably benign	0.04
R7059:Dzip3	UTSW	16	48980942	missense	probably benign	0.34
R7095:Dzip3	UTSW	16	48927790	missense	probably benign
R7227:Dzip3	UTSW	16	48951569	missense	probably damaging	0.99
R7319:Dzip3	UTSW	16	48927540	critical splice donor site	probably null
R7436:Dzip3	UTSW	16	48951989	missense	probably damaging	1.00
R7469:Dzip3	UTSW	16	48944879	missense	probably benign
R7526:Dzip3	UTSW	16	48975474	missense	probably damaging	0.99
R7964:Dzip3	UTSW	16	48951905	missense	probably damaging	1.00
R8131:Dzip3	UTSW	16	48933793	critical splice donor site	probably null
R8188:Dzip3	UTSW	16	48952136	missense	probably damaging	1.00
R8209:Dzip3	UTSW	16	48977944	missense	probably damaging	1.00
R8750:Dzip3	UTSW	16	48980975	missense	probably damaging	0.99
R8758:Dzip3	UTSW	16	48977937	missense	probably damaging	1.00
R8784:Dzip3	UTSW	16	48931265	missense	probably damaging	0.99
R9086:Dzip3	UTSW	16	48961130	missense	possibly damaging	0.81
R9157:Dzip3	UTSW	16	48927761	missense	probably benign
R9170:Dzip3	UTSW	16	48952038	missense	possibly damaging	0.74
R9762:Dzip3	UTSW	16	48928344	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CATCATTAGACAGGCATTAGGAAG -3'
(R):5'- GTGGGCAGCCAGTCTATAAC -3'

Sequencing Primer
(F):5'- ACAAGGCCCTTGATTTAACTCTCAGG -3'
(R):5'- CTGGTTTCAGTTTGTCCTGTGACATC -3'

Posted On

2018-02-27