Incidental Mutation 'R6218:Thumpd2'
ID503876
Institutional Source Beutler Lab
Gene Symbol Thumpd2
Ensembl Gene ENSMUSG00000024246
Gene NameTHUMP domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6218 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location81026327-81065085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81052913 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 244 (L244F)
Ref Sequence ENSEMBL: ENSMUSP00000025093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025093]
Predicted Effect probably damaging
Transcript: ENSMUST00000025093
AA Change: L244F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025093
Gene: ENSMUSG00000024246
AA Change: L244F

DomainStartEndE-ValueType
THUMP 175 266 4.08e-2 SMART
Pfam:UPF0020 272 425 3e-27 PFAM
Pfam:CMAS 284 429 3e-7 PFAM
Pfam:Ubie_methyltran 285 417 3e-10 PFAM
Pfam:MTS 289 417 2.1e-7 PFAM
Pfam:Methyltransf_31 296 441 7.8e-14 PFAM
Pfam:Methyltransf_11 303 406 1.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Tbx5 C T 5: 119,853,598 H245Y probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Thumpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01750:Thumpd2 APN 17 81054386 missense probably benign 0.00
IGL02409:Thumpd2 APN 17 81032688 missense probably damaging 1.00
IGL02546:Thumpd2 APN 17 81054455 missense probably benign 0.16
IGL03357:Thumpd2 APN 17 81044090 splice site probably benign
R1295:Thumpd2 UTSW 17 81055888 missense probably damaging 1.00
R2030:Thumpd2 UTSW 17 81064958 missense probably damaging 1.00
R2898:Thumpd2 UTSW 17 81044128 nonsense probably null
R4805:Thumpd2 UTSW 17 81026701 missense probably damaging 0.98
R4861:Thumpd2 UTSW 17 81026801 missense probably benign 0.03
R4861:Thumpd2 UTSW 17 81026801 missense probably benign 0.03
R5328:Thumpd2 UTSW 17 81044162 missense possibly damaging 0.64
R5359:Thumpd2 UTSW 17 81026777 missense probably benign 0.16
R6207:Thumpd2 UTSW 17 81055837 missense probably damaging 1.00
R6484:Thumpd2 UTSW 17 81054188 missense probably benign 0.01
R6853:Thumpd2 UTSW 17 81065030 missense possibly damaging 0.75
R6855:Thumpd2 UTSW 17 81044170 missense probably damaging 1.00
R6917:Thumpd2 UTSW 17 81044114 missense probably benign 0.00
R7018:Thumpd2 UTSW 17 81055897 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGGGGAAGACATTTTCTG -3'
(R):5'- GTAAAATTCAGCCCATTGCCTTG -3'

Sequencing Primer
(F):5'- CTGCACTATTTGGCTGTGAAAAAGC -3'
(R):5'- GCCTAGGCAATCTTTAGAGGCATAC -3'
Posted On2018-02-27