Incidental Mutation 'R6219:Lcn10'
ID503886
Institutional Source Beutler Lab
Gene Symbol Lcn10
Ensembl Gene ENSMUSG00000047356
Gene Namelipocalin 10
Synonyms9230112J07Rik
MMRRC Submission 044351-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6219 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25682726-25686081 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 25683575 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 55 (R55*)
Ref Sequence ENSEMBL: ENSMUSP00000059353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058912] [ENSMUST00000059693] [ENSMUST00000114197] [ENSMUST00000114199]
Predicted Effect probably null
Transcript: ENSMUST00000058912
AA Change: R55*
SMART Domains Protein: ENSMUSP00000059353
Gene: ENSMUSG00000047356
AA Change: R55*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Lipocalin 36 169 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059693
SMART Domains Protein: ENSMUSP00000055660
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114197
SMART Domains Protein: ENSMUSP00000109835
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 4.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114199
SMART Domains Protein: ENSMUSP00000109837
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lipocalin 33 172 2.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139441
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the lipocalin family, such as LCN10, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik T C 4: 136,462,748 S147P unknown Het
Acat2 T C 17: 12,960,717 probably benign Het
Ano2 A G 6: 125,815,590 D349G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ccnf C A 17: 24,226,704 E523* probably null Het
Ccr10 C T 11: 101,174,549 A52T possibly damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cmya5 T C 13: 93,094,443 E1379G probably damaging Het
Cyfip1 A G 7: 55,908,441 D822G possibly damaging Het
Cyp4a29 A C 4: 115,249,730 T195P probably damaging Het
Dmxl1 A T 18: 49,902,367 T2283S probably damaging Het
Dnah7b A G 1: 46,233,585 D2291G probably benign Het
Dock3 T A 9: 106,994,881 L493F probably damaging Het
Fbxw7 G A 3: 84,969,213 G227D probably damaging Het
Fmo2 A T 1: 162,880,516 V350D probably damaging Het
Glis1 C T 4: 107,631,905 P487S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,641 V485E probably damaging Het
Gm29776 G T 14: 54,695,659 Q356K noncoding transcript Het
Gm35315 G T 5: 110,078,544 T343K probably benign Het
Gpr141 A G 13: 19,752,527 I26T probably benign Het
Hectd4 T G 5: 121,308,878 V311G possibly damaging Het
Ino80d C T 1: 63,079,047 E322K possibly damaging Het
Irs2 A G 8: 11,005,121 S1104P probably damaging Het
Lama1 T C 17: 67,790,856 F1744L probably benign Het
Lrp2 A T 2: 69,469,478 C3077S probably damaging Het
Mdc1 T A 17: 35,850,674 S826R probably benign Het
Nr2c1 G T 10: 94,163,786 V103L probably benign Het
Nup133 A T 8: 123,936,873 D310E possibly damaging Het
Olfr1356 A G 10: 78,847,259 S219P possibly damaging Het
Pip5k1b T A 19: 24,381,823 E112D probably damaging Het
Reln T C 5: 21,948,596 K2237E probably damaging Het
Sirt2 A G 7: 28,767,515 probably benign Het
Slit2 A T 5: 48,302,428 H1350L possibly damaging Het
Snx15 A G 19: 6,121,508 S179P probably damaging Het
Sp8 T G 12: 118,848,667 S86A probably benign Het
Sptbn5 T C 2: 120,077,322 probably benign Het
Tfap4 A G 16: 4,547,311 S196P probably damaging Het
Tgm3 T C 2: 130,038,610 probably null Het
Tnks2 T C 19: 36,866,204 probably benign Het
Ttll11 A T 2: 35,752,499 probably null Het
Vwa3b C A 1: 37,100,698 Q367K possibly damaging Het
Zdhhc20 A T 14: 57,840,883 V312E probably damaging Het
Other mutations in Lcn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Lcn10 APN 2 25684020 unclassified probably benign
R0030:Lcn10 UTSW 2 25685081 missense probably damaging 1.00
R1832:Lcn10 UTSW 2 25685139 missense probably damaging 1.00
R1931:Lcn10 UTSW 2 25684335 missense probably damaging 1.00
R2890:Lcn10 UTSW 2 25683630 missense probably damaging 1.00
R4364:Lcn10 UTSW 2 25684040 missense probably damaging 1.00
R5511:Lcn10 UTSW 2 25682829 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGATCCTCTTCATTCTAGTCAGG -3'
(R):5'- GTGGAAGCACCTAACAAGGC -3'

Sequencing Primer
(F):5'- GGGTAGAACTCCCCTGTAGATAC -3'
(R):5'- GGCTACTCTCAGAACTCCACAGTTTC -3'
Posted On2018-02-27