Incidental Mutation 'R6219:Tgm3'
ID503890
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission 044351-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6219 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 130038610 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect probably null
Transcript: ENSMUST00000110299
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik T C 4: 136,462,748 S147P unknown Het
Acat2 T C 17: 12,960,717 probably benign Het
Ano2 A G 6: 125,815,590 D349G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ccnf C A 17: 24,226,704 E523* probably null Het
Ccr10 C T 11: 101,174,549 A52T possibly damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cmya5 T C 13: 93,094,443 E1379G probably damaging Het
Cyfip1 A G 7: 55,908,441 D822G possibly damaging Het
Cyp4a29 A C 4: 115,249,730 T195P probably damaging Het
Dmxl1 A T 18: 49,902,367 T2283S probably damaging Het
Dnah7b A G 1: 46,233,585 D2291G probably benign Het
Dock3 T A 9: 106,994,881 L493F probably damaging Het
Fbxw7 G A 3: 84,969,213 G227D probably damaging Het
Fmo2 A T 1: 162,880,516 V350D probably damaging Het
Glis1 C T 4: 107,631,905 P487S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,641 V485E probably damaging Het
Gm29776 G T 14: 54,695,659 Q356K noncoding transcript Het
Gm35315 G T 5: 110,078,544 T343K probably benign Het
Gpr141 A G 13: 19,752,527 I26T probably benign Het
Hectd4 T G 5: 121,308,878 V311G possibly damaging Het
Ino80d C T 1: 63,079,047 E322K possibly damaging Het
Irs2 A G 8: 11,005,121 S1104P probably damaging Het
Lama1 T C 17: 67,790,856 F1744L probably benign Het
Lcn10 A T 2: 25,683,575 R55* probably null Het
Lrp2 A T 2: 69,469,478 C3077S probably damaging Het
Mdc1 T A 17: 35,850,674 S826R probably benign Het
Nr2c1 G T 10: 94,163,786 V103L probably benign Het
Nup133 A T 8: 123,936,873 D310E possibly damaging Het
Olfr1356 A G 10: 78,847,259 S219P possibly damaging Het
Pip5k1b T A 19: 24,381,823 E112D probably damaging Het
Reln T C 5: 21,948,596 K2237E probably damaging Het
Sirt2 A G 7: 28,767,515 probably benign Het
Slit2 A T 5: 48,302,428 H1350L possibly damaging Het
Snx15 A G 19: 6,121,508 S179P probably damaging Het
Sp8 T G 12: 118,848,667 S86A probably benign Het
Sptbn5 T C 2: 120,077,322 probably benign Het
Tfap4 A G 16: 4,547,311 S196P probably damaging Het
Tnks2 T C 19: 36,866,204 probably benign Het
Ttll11 A T 2: 35,752,499 probably null Het
Vwa3b C A 1: 37,100,698 Q367K possibly damaging Het
Zdhhc20 A T 14: 57,840,883 V312E probably damaging Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7822:Tgm3 UTSW 2 130041899 missense probably benign 0.00
R7955:Tgm3 UTSW 2 130038480 missense probably benign
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGACATGATCTTCATCTTCGCG -3'
(R):5'- GTGCTCTGACGTTAACTCCC -3'

Sequencing Primer
(F):5'- CTTCGCGGAGGTTAATGCAGATC -3'
(R):5'- AACTCCCTCAGATATTGTAGCTG -3'
Posted On2018-02-27